Informazione

Quando si progettano i primer quanto è importante il morsetto GC?

Quando si progettano i primer quanto è importante il morsetto GC?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Sto progettando una serie di primer e leggendo i principi della progettazione dei primer, uno dei quali è:

Morsetto GC: la presenza di basi G o C nelle ultime cinque basi dall'estremità 3' dei primer (morsetto GC) aiuta a promuovere il legame specifico all'estremità 3' grazie al legame più forte delle basi G e C. Evitare più di 3 G o C nelle ultime 5 basi all'estremità 3' del primer.

Da qui.

La mia domanda è: quanto è essenziale avere un morsetto GC?


Difficile dare una risposta obiettiva. Se hai una discreta lunghezza e una buona complessità, anche un solo terminale 3'GoCfarebbe. Certo, bisogna tener conto dell'insieme del primerGC: ATrapporto e cose come la temperatura di ricottura.

Ecco un link a diverse opinioni sull'argomento e ha questa pepita (a cui sottoscrivo quando possibile):

FWIW, le mie offerte preferite agli dei della PCR sono primer con un singolo G o C 3', FWIW. Sembra tenerli felici per la maggior parte delle fasi lunari.


Offrirò il mio resoconto (empirico) del disegno di primer. Un morsetto GC aiuta nella specificità del priming e quindi contribuisce all'efficienza complessiva della reazione PCR. In passato, ho progettato (per necessità) primer che avevano sia un eccessivo bloccaggio del GC all'estremità 3', sia utilizzato primer senza alcun bloccaggio del GC. Queste reazioni PCR sono state eseguite con successo, con diversi livelli di formazione di primer-dimero ed efficienza complessiva.

Nella mia esperienza, il bloccaggio del GC è buono, ma non strettamente necessario per una buona PCR. La mia regola generale è di terminare i miei primer con 2 G/C ove possibile. Se qualcosa non funziona, di solito non è la PCR.


Bloccaggio GC a 3', cioè avere un singoloGoCall'estremità 3' o un paio diSOL/DOentro gli ultimi 6 bp all'estremità 3' del primer, può aiutare a trattenere il primer sul modello durante l'allungamento, a causa del legame più forte rispetto aA=T. Questo non è obbligatorio; è uno dei caratteri del primer che potrebbe migliorare la tua reazione PCR.

Allo stesso tempo, evitare una combinazione sequenziale diGCnegli ultimi 6bp che potrebbe portare ad auto-dimeri.

Esempio:
5'-… GCGC-3'ha maggiori possibilità di formazione di dimeri rispetto a5'-… GCG-3'; in questi casi è ancora possibile utilizzare quest'ultima sequenza di primer.


A meno che tu non stia PCRing qualcosa che sai essere impegnativo, usa semplicemente primer3 e non preoccuparti.

http://bioinfo.ut.ee/primer3-0.4.0/


Come progettare primer per QPCR

La PCR quantitativa o in tempo reale viene utilizzata come saggio di routine per il monitoraggio dei relativi cambiamenti nell'espressione genica in diverse condizioni sperimentali. La progettazione di primer e sonde durante la QPCR è uno dei fattori più cruciali che influenzano la qualità e il successo del test. Diverse linee guida sono applicabili per la progettazione di primer per QPCR: il contenuto di GC dei primer dovrebbe essere del 35-65% la temperatura di fusione dei primer dovrebbe essere compresa tra 60 e 68 ° C si dovrebbero anche evitare le strutture secondarie, le ripetizioni di G o C che sono più lunghe di 3 basi e formazione di primer-dimeri.

Aree chiave coperte

1. Che cos'è la QPCR
– Definizione, processo, usi
2. Come progettare primer per QPCR
– Linee guida per la progettazione del primer per QPCR

Termini chiave: coloranti fluorescenti, contenuto GC, temperatura di fusione, primer, PCR quantitativa (QPCR)


Progettazione primer - Morsetto GC

Poiché G's e C's si legano più fortemente di A e T, averne troppi alla fine di un primer può causare l'aumento di Tm e fare in modo che il morsetto GC del primer sia troppo forte, impedendolo dalla denaturazione alla temperatura appropriata. Avere 1 o 2 G' o C' alla fine del primer è l'ideale, perché consente un forte legame del primer al cDNA, rendendolo più specifico, senza legarsi troppo forte.

#3 Tintin

#4 altobarn

#5 wilson_trace

Sto utilizzando un software disponibile gratuitamente su Internet per progettare primer. Lo strumento mi direbbe quindi se il primer è ben progettato o meno. In alcuni casi ricevo l'avviso che dice ''Ci sono più di 3 G' o C' nelle ultime 5 basi''. Cosa succederebbe se avessi il primer in quel caso?

Ciao,
Per quanto ne so, avere un alto contenuto di GC facilita il legame stretto dell'oligo allo stampo ma aumenta anche la possibilità di mispriming.
Posso sapere, quale software stai usando per controllare i tuoi primer? Uso NetPrimer di Primer Biosoft: http://www.premierbi. imer/index.html

#6 fago434

#7 Bassaml7

#8 LaLeLi

Questa domanda sul morsetto GC su 3'estremità dei primer mi interessa molto.
In questo momento, sto usando Primer 3 per selezionare i primer da una sequenza e nel campo del parametro clamp GC, ho scelto il clamp GC uguale a 0, 1 o 2 e ho selezionato i primer per ogni situazione (tutto il resto è uguale). I primer inversi risultanti erano diversi per ciascuno e solo il primer diretto risultante da una situazione di un morsetto GC = 0 era diverso dagli altri.

Ho avuto dei problemi nel tentativo di amplificare questo locus con i primer originali progettati per esso. Dovrebbero funzionare in una regione conservata (un esone), ma le amplificazioni che ho ottenuto non sono mai state coerenti quando si tratta dell'intensità della banda amplificata. Quindi ho deciso di provare a scegliere altri primer più all'interno degli esoni che fiancheggiano la mia sequenza target, nella speranza di avere primer funzionanti che potrebbero non essere soggetti a nessuna mutazione putativa.

Quindi, mi chiedo se i primer prelevati con GC clamp = 0 forzeranno un'amplificazione meno specifica, ma dall'altro aumenteranno i cambiamenti di resa di qualsiasi prodotto, specialmente per procedere al sequenziamento in seguito?


Risultati e discussione

Per determinare se il morsetto GC deve essere collegato all'estremità 5' o 3' di ciascun frammento PCR, è necessario confrontare le rispettive mappe di fusione. Come esempio mostriamo le curve di fusione teoriche dell'esone 8 del RET gene (Fig. 1A). Quando si collega il morsetto GC al primer in avanti sono stati previsti diversi domini di fusione (Fig. 1B). Quando, tuttavia, un morsetto GC è attaccato al primer inverso, viene creato un profilo di fusione a due domini ideale costituito da un singolo dominio di fusione inferiore piatto. Tuttavia, un profilo di fusione a due domini così ottimale non si trova in tutte le situazioni. Ciò solleva la questione se i frammenti di PCR con grafici di fusione imperfetti possano essere utilizzati per il rilevamento appropriato delle variazioni della coppia di basi e se semplici modifiche dei frammenti di PCR/sequenze di primer possano alterare i frammenti inadatti (DGGE) per diventare adatti per l'analisi DGGE pur mantenendo un ottimale rilevamento della mutazione. Di seguito presentiamo esempi di una serie di tali situazioni.

Domini di fusione multipli

Quando un frammento di DNA con due o più diversi domini di fusione viene separato mediante elettroforesi in un gel DGGE, il frammento verrà arrestato nella posizione nel gel in cui la concentrazione del denaturante dissocia il frammento nel suo dominio di fusione più basso. Quando la mobilità diminuisce, il frammento potrebbe non raggiungere la posizione nel gel in cui si scioglierà il secondo dominio di fusione. La maggior parte di questi frammenti parzialmente fusi appaiono come bande nitide e focalizzate, dando l'idea che il frammento sia adatto per il rilevamento della mutazione da parte di DGGE. Quando i frammenti contengono due domini di fusione (non tenendo conto del morsetto GC), la soluzione più ovvia a questo problema è dividere questo frammento in due ampliconi. Ciò, tuttavia, non è sempre necessario. Per illustrare che frammenti con curve di fusione imperfette possono essere utilizzati per DGGE presentiamo l'esone 13 del MSH2 gene (Fig. 2A). Quando si analizza il frammento con un morsetto GC, è possibile ottenere il melt plot "ideale" solo quando il primer si trovava all'interno dell'esone. Quando si sceglie il primer GC-clamp 99 bp a monte del confine introne-esone, è apparso un dominio di fusione inferiore (4 ° C) tra il morsetto GC e il dominio di fusione superiore all'estremità 3' del frammento ( Fig. 2B). Questo frammento si è sciolto come striscio (Fig. 2C) e non è stato possibile rilevare una mutazione frameshift nota (del693T 9) (Fig. 2B). Quando si sceglie un primer bloccato da GC 29 bp a monte del confine introne-esone, il dominio di fusione più basso interno all'estremità 5' del frammento aveva un Tm valore 1.0°C inferiore al secondo dominio ( Fig. 2E). La mutazione del693T potrebbe essere rilevata facilmente (Fig. 2F).

Da questo esempio e da diversi casi comparabili testati, concludiamo che un frammento con un dominio interno a basso punto di fusione può essere utilizzato per DGGE, a condizione che il Tm il valore di questo dominio a basso punto di fusione differisce di non più di 1°C dai domini adiacenti e non è più lungo di 50–100 bp.

Domini di fusione multipli: mappe di fusione teoriche e analisi DGGE sperimentale per MSH2 l'esone 13 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 328 bp senza GC-clamp mostra due domini di temperatura stabili. (B) La mappa di fusione del frammento con GC-clamp mostra un dominio di fusione interno con a Tm valore che differisce di 4°C dal secondo dominio (linea continua). (C) Analisi DGGE del viaggio nel tempo del frammento di 328 bp con il morsetto GC all'estremità 5'. Non è stato possibile rilevare la mutazione (del693T). (D) Mappa di fusione di un frammento di 258 bp senza un morsetto GC. Una sequenza intronica di 70 bp è stata rimossa dall'estremità 5' del frammento originale di 328 bp. (E) La mappa di fusione del frammento di 258 bp con un morsetto GC mostra un dominio di fusione interno avente a Tm valore 0,5°C inferiore al secondo dominio (linea continua). (F) Analisi DGGE del viaggio nel tempo del frammento di 258 bp con il morsetto GC all'estremità 5'. La mutazione (del693T) potrebbe ora essere rilevata.

Domini di fusione multipli: mappe di fusione teoriche e analisi DGGE sperimentale per MSH2 esone 13 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 328 bp senza GC-clamp mostra due domini di temperatura stabili. (B) La mappa di fusione del frammento con GC-clamp mostra un dominio di fusione interno con a Tm valore che differisce di 4°C dal secondo dominio (linea continua). (C) Analisi DGGE del viaggio nel tempo del frammento di 328 bp con il morsetto GC all'estremità 5'. Non è stato possibile rilevare la mutazione (del693T). (D) Mappa di fusione di un frammento di 258 bp senza un morsetto GC. Una sequenza intronica di 70 bp è stata rimossa dall'estremità 5' del frammento originale di 328 bp. (E) La mappa di fusione del frammento di 258 bp con un morsetto GC mostra un dominio di fusione interno avente a Tm valore 0,5°C inferiore al secondo dominio (linea continua). (F) Analisi DGGE del viaggio nel tempo del frammento di 258 bp con il morsetto GC all'estremità 5'. La mutazione (del693T) potrebbe ora essere rilevata.

Attaccamento dei nucleotidi G/C

Quando un frammento di DNA è costituito da tre domini di fusione (come illustrato nella Fig. 3A) il rilevamento della mutazione è possibile solo nel dominio di fusione più basso e non è possibile nel dominio più alto (non fuso). Quando questo dominio a punto di fusione più basso è corto, <50 bp, e si trova su una delle estremità del frammento ( Fig. 3A) una soluzione per questa condizione è l'aggiunta di un tratto di nucleotidi G/C (da tre a sette) a questa estremità del frammento attraverso il primer corto. Questo primer modificato aumenterà la Tm valore del piccolo dominio di fusione più bassa e quindi promuovere la creazione del profilo a due domini desiderato. Per illustrare i risultati dell'aggiunta di residui G e/o C al primer corto, abbiamo esaminato l'esone 7 del BRCA2 gene (Fig. 3A). Per determinare il comportamento di fusione del frammento, abbiamo introdotto una mutazione nel primer forward (10). I frammenti senza un tratto aggiunto di nucleotidi GC hanno mostrato una riduzione della mobilità e sono apparsi come una singola banda focalizzata nitida dopo 5 h di elettroforesi a 150 V (Fig. 3B). I risultati possono essere interpretati solo come assenza di mutazioni in questo frammento. Quando tre basi (CGC) sono state attaccate all'estremità 3' del frammento, attraverso il primer corto inverso, la mappa di fusione calcolata di questo frammento prevedeva che il Tm del dominio di fusione più bassa differirebbe di ∼1°C dall'altro dominio ( Fig. 3C). Sebbene la curva di fusione non sia ottimale, la mutazione potrebbe essere rilevata dopo 7-8 h di elettroforesi a 150 V (Fig. 3D). Quando sono state aggiunte cinque o sette basi all'estremità 3' del frammento, è stato creato il profilo a due domini teorico desiderato e la mutazione è stata risolta dopo 6-7 h di elettroforesi a 150 V (dati non mostrati).

Attaccamento di nucleotidi G/C: mappe di fusione teoriche e analisi sperimentale DGGE per BRCA2 l'esone 7 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 203 bp senza (linea continua) e con GC-clamp (linea tratteggiata) mostra più domini di fusione. (B) Analisi DGGE del viaggio nel tempo del frammento di 203 bp. Il frammento appare come una singola banda focalizzata e non è stato possibile rilevare la mutazione. (C) La mappa di fusione del frammento senza (linea continua) e con un morsetto GC (linea tratteggiata) mostra che il Tm il valore del dominio a punto di fusione più basso differisce solo di 1°C dall'altro dominio quando vengono aggiunte tre basi (GCG) all'estremità 3′. (D) Analisi DGGE nel tempo del frammento con tre basi (GCG) aggiunte al primer corto inverso. La mutazione è facilmente rilevabile.

Attaccamento di nucleotidi G/C: mappe di fusione teoriche e analisi sperimentale DGGE per BRCA2 esone 7 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 203 bp senza (linea continua) e con GC-clamp (linea tratteggiata) mostra più domini di fusione. (B) Analisi DGGE del viaggio nel tempo del frammento di 203 bp. Il frammento appare come una singola banda focalizzata e non è stato possibile rilevare la mutazione. (C) La mappa di fusione del frammento senza (linea continua) e con un morsetto GC (linea tratteggiata) mostra che il Tm il valore del dominio a punto di fusione più basso differisce solo di 1°C dall'altro dominio quando vengono aggiunte tre basi (GCG) all'estremità 3′. (D) Analisi DGGE nel tempo del frammento con tre basi (GCG) aggiunte al primer corto inverso. La mutazione è facilmente rilevabile.

Pertanto, sulla base di calcoli al computer e sperimentazione pratica, proponiamo che l'attaccamento di un piccolo tratto di nucleotidi G/C al primer corto possa migliorare il rilevamento della mutazione in queste condizioni. Va notato, tuttavia, che lo stiramento dei nucleotidi G/C non deve superare le 10 basi, poiché ciò introdurrà una piccola porzione altamente ricca di GC nel frammento, risultando in strisci o bande diffuse in un gel DGGE (dati non mostrati ).

Attaccamento dei nucleotidi A/T

Quando le informazioni sulla sequenza sono limitate, potrebbe essere impossibile selezionare i primer senza avere un dominio ricco di GC vicino al sito di attacco del morsetto GC del frammento (Fig. 4A). Di conseguenza, mancheranno le mutazioni in questi domini di fusione più elevati. Abbiamo ipotizzato che l'inserimento di un tratto di 15-20 nucleotidi T tra il morsetto GC e il primer specifico potrebbe ridurre la Tm valore della sequenza ricca di GC e quindi rendere possibile il rilevamento della mutazione nel dominio di fusione superiore. Per verificarlo abbiamo esaminato l'esone 9 del MSH2 gene (Fig. 4A). Per ottenere il profilo di fusione a due domini (teoricamente) desiderato, è stato necessario inserire 20 nucleotidi T all'estremità 3' o 15 nucleotidi T all'estremità 5' tra il morsetto GC e il primer specifico (Fig. 4C). Per verificare ciò abbiamo esaminato una sostituzione g→t situata nel sito dell'accettore di splicing nell'introne 8 (9) presente in un dominio ad alto punto di fusione. Come previsto, data la sua posizione all'interno della porzione altamente ricca di GC in posizione nucleotidica -1 (Fig. 4A), la mutazione non è stata rilevata quando il morsetto GC era direttamente attaccato al primer diretto (Fig. 4B). La mutazione, tuttavia, è stata rilevata quando 15 nucleotidi T sono stati inseriti tra il morsetto GC e il primer diretto (Fig. 4D).

Attaccamento di nucleotidi A/T: mappe di fusione teoriche e analisi sperimentale DGGE per MSH2 esone 9 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 208 bp con un morsetto GC su entrambi i lati mostra domini ad alto punto di fusione su entrambi i lati. (B) Analisi DGGE del viaggio nel tempo del frammento di 208 bp con il morsetto GC all'estremità 5'. Non è stato possibile rilevare una mutazione del sito di giunzione situata all'interno del dominio ad alto punto di fusione. (C) La mappa di fusione del frammento mostra un profilo di fusione ottimale a due domini quando vengono inseriti 20 nucleotidi T tra il primer inverso e il morsetto GC (linea tratteggiata) o 15 nucleotidi T tra il primer diretto e il morsetto GC (linea continua) . (D) Analisi DGGE del viaggio nel tempo del frammento di 208 bp con 15 nucleotidi T tra il primer diretto e il morsetto GC. La mutazione è chiaramente visibile.

Attaccamento di nucleotidi A/T: mappe di fusione teoriche e analisi sperimentale DGGE per MSH2 esone 9 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 208 bp con un morsetto GC su entrambi i lati mostra domini ad alto punto di fusione su entrambi i lati. (B) Analisi DGGE del viaggio nel tempo del frammento di 208 bp con il morsetto GC all'estremità 5'. Non è stato possibile rilevare una mutazione del sito di giunzione situata all'interno del dominio ad alto punto di fusione. (C) La mappa di fusione del frammento mostra un profilo di fusione ottimale a due domini quando vengono inseriti 20 nucleotidi T tra il primer inverso e il morsetto GC (linea tratteggiata) o 15 nucleotidi T tra il primer diretto e il morsetto GC (linea continua) . (D) Analisi DGGE del viaggio nel tempo del frammento di 208 bp con 15 nucleotidi T tra il primer diretto e il morsetto GC. La mutazione è chiaramente visibile.

L'inserimento di nucleotidi T tra il GC-clamp e il primer specifico consente il rilevamento della mutazione in piccole regioni altamente ricche di GC vicino al primer GC-clamp.

Dominio ad alto punto di fusione alla fine di un frammento di DNA: mappe di fusione teoriche e analisi DGGE sperimentale per RET l'esone 13 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 278 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione all'estremità 3'. Un profilo a due domini ideale si ottiene collegando un morsetto GC all'estremità 5′ (linea tratteggiata). (B) Analisi DGGE del viaggio nel tempo del frammento di 278 bp con un dominio ad alto punto di fusione all'estremità 3'. Il frammento ha dato bande indistinte e la mutazione (S767R) non è stata rilevata. (C) La mappa di fusione di un frammento di 234 bp senza GC-clamp (linea continua) mostra un singolo dominio di fusione. Una sequenza intronica di 44 bp è stata rimossa dall'estremità 3' del frammento di 278 bp. La mappa di fusione del frammento di 234 bp con GC-clamp (linea tratteggiata) mostra due domini con Tm. (D) Analisi DGGE del viaggio nel tempo del frammento di 234 bp senza dominio ad alto punto di fusione all'estremità 3'.La mutazione (S767R) è chiaramente visibile.

Dominio ad alto punto di fusione alla fine di un frammento di DNA: mappe di fusione teoriche e analisi DGGE sperimentale per RET l'esone 13 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 278 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione all'estremità 3'. Un profilo a due domini ideale si ottiene collegando un morsetto GC all'estremità 5′ (linea tratteggiata). (B) Analisi DGGE del viaggio nel tempo del frammento di 278 bp con un dominio ad alto punto di fusione all'estremità 3'. Il frammento ha dato bande indistinte e la mutazione (S767R) non è stata rilevata. (C) La mappa di fusione di un frammento di 234 bp senza GC-clamp (linea continua) mostra un singolo dominio di fusione. Una sequenza intronica di 44 bp è stata rimossa dall'estremità 3' del frammento di 278 bp. La mappa di fusione del frammento di 234 bp con GC-clamp (linea tratteggiata) mostra due domini con Tm. (D) Analisi DGGE del viaggio nel tempo del frammento di 234 bp senza dominio ad alto punto di fusione all'estremità 3'. La mutazione (S767R) è chiaramente visibile.

Dominio ad alto punto di fusione alla fine di un frammento di DNA

Ci siamo imbattuti in diversi ampliconi con curve di fusione perfette (frammenti con GC-clamp) che, tuttavia, quando sottoposti a elettroforesi in un gel DGGE hanno provocato sbavature o bande diffuse. Dopo l'analisi della curva di fusione delle sequenze native (frammenti senza GC-clamp), abbiamo osservato che ad un'estremità del frammento era presente un dominio ad alto punto di fusione. L'effetto di questo dominio ad alto punto di fusione sul rilevamento della mutazione da parte di DGGE può essere illustrato da un'analisi dell'esone 13 del RET gene (Fig. 5A). L'analisi DGGE di una sostituzione T→G (S767R) nell'esone 13 del RET gene localizzato alla posizione nucleotidica 18 del frammento mostra che si possono osservare solo bande indistinte (Fig. 5B). Ciò dimostra una discrepanza tra il diagramma di fusione teorico calcolato da MELT87 e il comportamento di fusione "reale" pratico del frammento PCR. Il modo più semplice per risolvere questo problema è rimuovere la sequenza ricca di GC. In questo caso, potremmo rimuovere 44 bp dall'estremità 3' del frammento senza rimuovere alcuna sequenza di codifica. Sebbene la curva di fusione teorica non sia perfetta (Fig. 5C), la Figura 5D mostra quattro bande distinte. Dati teorici e osservazioni pratiche simili sono stati ottenuti per gli esoni 14 e 15 del RET gene (dati non mostrati). Poiché è stato riportato che un breve tratto di sequenza ricca di AT potrebbe diminuire il Tm valore di una piccola regione ricca di GC ( 11), abbiamo cercato di risolvere il problema sopra menzionato introducendo un tratto di sette nucleotidi AT all'estremità 3' del primer corto inverso. Tuttavia, questo non ha avuto successo (dati non mostrati). L'uso di un tratto più lungo di nucleotidi AT (>20 nt) introdurrà un dominio a basso punto di fusione risultante in una struttura a tre domini non ottimale.

Dominio ad alto punto di fusione nel mezzo di un frammento: mappa di fusione teorica e analisi sperimentale DGGE per CFTR l'esone 2 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 217 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione nella parte centrale di questo frammento. Un profilo a due domini ideale si ottiene collegando un morsetto GC all'estremità 3′ (linea tratteggiata). (B) L'analisi DGGE del frammento di 217 bp rivela la rilevazione di tutte e tre le mutazioni mediante la presenza di tre o quattro bande. Le corsie 1-4 mostrano un campione di controllo, rispettivamente 186-13c→g, 241delAT e 296+2t→c.

Dominio ad alto punto di fusione nel mezzo di un frammento: mappa di fusione teorica e analisi sperimentale DGGE per CFTR l'esone 2 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 217 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione nella parte centrale di questo frammento. Un profilo a due domini ideale si ottiene collegando un morsetto GC all'estremità 3′ (linea tratteggiata). (B) L'analisi DGGE del frammento di 217 bp rivela la rilevazione di tutte e tre le mutazioni dalla presenza di tre o quattro bande. Le corsie 1-4 mostrano un campione di controllo, rispettivamente 186-13c→g, 241delAT e 296+2t→c.

Lunghezza del morsetto GC: mappa di fusione teorica e analisi DGGE sperimentale per RET l'esone 5 e le sue sequenze introniche fiancheggianti. (UN) Le mappe di fusione di un frammento di 295 bp con un morsetto GC di 40 (linea continua) e di 60 bp (linea tratteggiata) mostrano profili di fusione simili. (B) Analisi DGGE del viaggio nel tempo del frammento da 295 bp con un morsetto GC da 40 bp. Il frammento appare come bande diffuse dopo 8 h di elettroforesi a 150 V. (C) Analisi DGGE del viaggio nel tempo del frammento da 295 bp con un morsetto GC da 60 bp. Il frammento dà una banda nettamente focalizzata.

Lunghezza del morsetto GC: mappa di fusione teorica e analisi DGGE sperimentale per RET l'esone 5 e le sue sequenze introniche fiancheggianti. (UN) Le mappe di fusione di un frammento di 295 bp con un morsetto GC di 40 (linea continua) e di 60 bp (linea tratteggiata) mostrano profili di fusione simili. (B) Analisi DGGE del viaggio nel tempo del frammento da 295 bp con un morsetto GC da 40 bp. Il frammento appare come bande diffuse dopo 8 h di elettroforesi a 150 V. (C) Analisi DGGE del viaggio nel tempo del frammento da 295 bp con un morsetto GC da 60 bp. Il frammento dà una banda nettamente focalizzata.

Se l'analisi di fusione di un frammento corto (<200 bp) prevede un dominio ad alto punto di fusione di dimensioni <40 bp situato all'estremità del frammento e che differisce di non più di 5°C in Tm valore, questo frammento molto probabilmente è adatto per l'analisi DGGE. Quando, tuttavia, un dominio ad alto punto di fusione (>50 bp in dimensione e diverso dal resto di 5°C in Tm valore) si trova a un'estremità di un frammento di DNA, può influenzare significativamente il comportamento di fusione del frammento anche dopo il fissaggio di un morsetto GC.

Morsetto naturale: mappe di fusione teoriche e analisi sperimentale DGGE per MSH2 l'esone 1 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 271 bp con un morsetto GC di 40 bp all'estremità 5' (linea tratteggiata) mostra un profilo ideale a due domini. (B) Analisi DGGE del viaggio nel tempo del frammento da 271 bp con il morsetto GC da 40 bp. Il frammento è diventato completamente a singolo filamento ed è uscito dal gel dopo 7 h di elettroforesi a 150 V. (C) La mappa di fusione di un frammento di 299 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione naturale di 60 bp all'estremità 3′. Mappa di fusione del frammento da 299 bp con un morsetto GC da 55 bp che mostra un dominio ad alto punto di fusione di 100 bp all'estremità 3′. (D) Analisi DGGE del viaggio nel tempo del frammento da 299 bp con il morsetto GC da 55 bp. Il frammento fornisce una singola banda tagliente dopo 9 h di elettroforesi a 150 V.

Morsetto naturale: mappe teoriche di fusione e analisi sperimentale DGGE per MSH2 l'esone 1 e le sue sequenze introniche fiancheggianti. (UN) La mappa di fusione di un frammento di 271 bp con un morsetto GC di 40 bp all'estremità 5' (linea tratteggiata) mostra un profilo ideale a due domini. (B) Analisi DGGE del viaggio nel tempo del frammento da 271 bp con il morsetto GC da 40 bp. Il frammento è diventato completamente a singolo filamento ed è uscito dal gel dopo 7 h di elettroforesi a 150 V. (C) La mappa di fusione di un frammento di 299 bp senza GC-clamp (linea continua) mostra un dominio ad alto punto di fusione naturale di ∼60 bp all'estremità 3′. Mappa di fusione del frammento da 299 bp con un morsetto GC da 55 bp che mostra un dominio ad alto punto di fusione di 100 bp all'estremità 3′. (D) Analisi DGGE del viaggio nel tempo del frammento da 299 bp con il morsetto GC da 55 bp. Il frammento fornisce una singola banda tagliente dopo 9 h di elettroforesi a 150 V.

Dominio ad alto punto di fusione nel mezzo di un frammento

Da quanto precede è chiaro che nella progettazione di un sistema di rilevamento delle mutazioni DGGE, devono essere esaminate le curve di fusione sia dei frammenti bloccati che di quelli sbloccati. In diversi casi abbiamo trovato un dominio ricco di GC nel mezzo di un frammento, visibile come picco nel profilo di fusione della sequenza nativa, ma non visibile dopo l'aggiunta di un morsetto GC (Fig. 6A). Per determinare se un dominio di fusione così alto ha un'influenza sulla rilevazione di mutazioni nel dominio, abbiamo esaminato CFTR esone 2, di cui la mappa di fusione con e senza un morsetto 3'-GC è mostrata in Figura 6A. Abbiamo esaminato tre mutazioni note localizzate nel mezzo di questo frammento: 186-13c→g alla posizione nucleotidica -13 241delAT alla posizione nucleotidica 39 del frammento, localizzata nel picco del dominio di fusione (79°C) 296+2t→c alla posizione del nucleotide +2 ( Fig. 6A). La Figura 6B mostra un'analisi DGGE delle tre mutazioni nell'esone 2 del CFTR gene. Tutte e tre le mutazioni sono state facilmente rilevate. Dati teorici simili e osservazioni pratiche sono stati ottenuti per l'esone 5 del TP53 gene, che ha un picco un po' più ampio nel mezzo del frammento (dati non mostrati). Pertanto, le mutazioni localizzate in tali domini ad alto punto di fusione non rappresentano un problema per il rilevamento.

Per DGGE, dovrebbero essere scelti preferibilmente frammenti PCR corti (<300 bp), perché un morsetto GC ha un effetto più forte sulle proprietà di fusione dei frammenti corti. Frammenti adatti per DGGE possono quindi essere generati più facilmente. In frammenti lunghi (>400 bp), un grande dominio interno ad alto punto di fusione (100 bp) può avere un impatto sostanziale, poiché il morsetto GC ha un effetto relativamente scarso sul comportamento di fusione della porzione centrale, ad esempio, l'esone 4 del TP53 gene (11). Mutazioni localizzate nel dominio ad alto punto di fusione (lunghezza 100 bp, che differisce di 6°C in Tm valore) e nel dominio tra questo dominio ad alto punto di fusione e il morsetto GC non è stato possibile rilevare utilizzando un singolo frammento PCR in DGGE (dati non mostrati).

Concludiamo che mentre la presenza di un dominio ad alto punto di fusione nel mezzo di un piccolo frammento (<300 bp) consente ancora una buona analisi di mutazione, la sua presenza nel mezzo di un grande frammento PCR (>400 bp) rende il frammento inadatto per l'analisi DGGE .

Lunghezza del morsetto GC

Diversi studi (3, 5) hanno indicato che un morsetto GC di appena 30 bp sarebbe sufficiente in DGGE. Questo può essere vero per frammenti ricchi di AT, ma per una sequenza ricca di GC la differenza in Tm con un morsetto GC potrebbe diventare troppo piccolo. Anche il morsetto GC standard da 40 bp potrebbe non essere sufficiente per prevenire la dissociazione totale del filamento. Qui, dimostriamo l'effetto della lunghezza del morsetto GC su frammenti ricchi di GC con l'esone 5 del RET gene come esempio. L'analisi di fusione del frammento ha rivelato a Tm valore di 80°C. L'attacco di morsetti GC da 40 e 60 bp all'estremità 3' del frammento ha fornito profili di fusione teorici simili (Fig. 7A). Il frammento con il morsetto GC da 40 bp diventa completamente a singolo filamento e fuoriesce dal gel ( Fig. 7B e anche Fig. 8A e B), mentre il frammento con morsetto GC da 60 bp si è fuso come una singola banda tagliente ( Fig. 7C ).

Per sequenze estremamente ricche di GC (Tm > 80°C), come di solito accade per il primo esone della maggior parte dei geni, la differenza in Tm i valori tra il morsetto GC e la sequenza target possono essere così piccoli che anche un morsetto GC da 60 bp potrebbe non essere sufficiente per prevenire la dissociazione totale del filamento, sebbene la curva di fusione possa essere perfetta. Se possibile, è possibile utilizzare un dominio naturale ad alto punto di fusione in combinazione con un morsetto GC più lungo (Fig. 8C). Come esempio mostriamo l'esone 1 del MSH2 gene (Fig. 8A-D). Quando si analizza il comportamento di fusione di un frammento di 299 bp, diventa visibile un dominio naturale ad alto punto di fusione di 60 bp all'estremità 3′ del frammento (Fig. 8C). Aggiungendo un morsetto GC da 55 bp all'estremità 3' di questa molecola, è stato creato un dominio ad alto punto di fusione di 100 bp (Fig. 8C). Quando si esegue questo frammento di PCR in un gel DGGE, si ottiene una singola banda affilata che si scioglie a una concentrazione di UF appropriata (Fig. 8D).

Concludiamo che per frammenti con a Tm valore vicino a 80°C un morsetto GC con una lunghezza di 60 bp migliorerà il rilevamento della mutazione. DGGE per frammenti con a Tm valore >80°C potrebbe essere possibile solo quando si utilizza un lungo morsetto GC in combinazione con un dominio ricco di GC "naturale".


PRIMER PER PCR DI PROGETTAZIONE

INFORMAZIONI DI BASE: Per i siti che descrivono la teoria della PCR, così come le aziende che commercializzano prodotti PCR, potresti iniziare visitando Highveld. Per le tecniche PCR vedere PCRlink.com.

Esistono diversi siti eccellenti per la progettazione di primer per PCR:

Primer3: strumento primer WWW (Università del Massachusetts Medical School, U.S.A.) &ndash Questo sito dispone di un programma di progettazione di primer per PCR molto potente che consente un controllo considerevole sulla natura dei primer, compresa la dimensione del prodotto desiderato, la dimensione del primer e l'intervallo Tm e la presenza/assenza di un morsetto 3&rsquo-GC.
GeneFisher - Progettazione interattiva di primer per PCR (Università Bielefeld, Germania) - un ottimo sito che consente un ottimo controllo sulla progettazione del primer.

Primer3Plus - una nuova interfaccia web migliorata per il popolare programma di progettazione di primer Primer3 (Riferimento: A. Untergasser et al. 2007. Nucl. Acids Res. 35(problema del server Web): W71-W74)
BiSearch Primer Design and Search Tool - questo è uno strumento utile per la progettazione di primer per qualsiasi modello di DNA e in particolare per i genomi trattati con bisolfito. Lo strumento ePCR fornisce un rilevamento rapido di siti di mispriming e prodotti PCR alternativi nelle librerie di cDNA e nei genomi nativi o trattati con bisolfito. (Riferimento: Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST è stato sviluppato presso l'NCBI per aiutare gli utenti a creare primer specifici per il modello di PCR di input. Utilizza Primer3 per progettare primer per PCR e quindi li invia alla ricerca BLAST nel database selezionato dall'utente. I risultati dell'esplosione vengono quindi analizzati automaticamente per evitare coppie di primer che possono causare l'amplificazione di bersagli diversi dal modello di input.

MFEprimer consente agli utenti di controllare la specificità del primer rispetto al DNA genomico e ai database di sequenze di DNA genomico e RNA messaggero/complementare in modo rapido e semplice. Questo server utilizza un algoritmo di indice k-mer per accelerare il processo di ricerca dei siti di legame dei primer e utilizza la termodinamica per valutare la stabilità del legame tra ciascun primer e il relativo modello di DNA. Sono riportate diverse caratteristiche importanti, come la sequenza, la temperatura di fusione e la dimensione di ciascun amplicone, specifico o non specifico. (Riferimento: Qu W et al. 2012. Nucl. Acids Res. 40 (problema del server Web): W205-W208)

Strumento di progettazione e ricerca di primer

PrimerDesign-M: include diverse opzioni per la progettazione di primer multipli, consentendo ai ricercatori di progettare in modo efficiente primer che coprono lunghi bersagli di DNA, come interi genomi di HIV-1, e che ottimizza i primer informati contemporaneamente dalla diversità genetica in più allineamenti e vincoli di progettazione sperimentale dato dall'utente. PrimerDesign-M può anche progettare primer che includono codici a barre del DNA e ridurre al minimo la dimerizzazione del primer. PrimerDesign-M trova primer ottimali per bersagli di DNA altamente variabili e facilita la flessibilità di progettazione suggerendo progetti alternativi per adattarsi alle condizioni sperimentali. (Riferimento: Yoon H & Leitner T. 2015. Bioinformatica 31:1472-1474).

Clonazione RF (clonazione senza restrizioni) - è una tecnologia basata su PCR che espande il processo di mutagenesi QuikChange&trade originariamente reso popolare da Stratagene a metà degli anni '90 e consente l'inserimento di praticamente qualsiasi sequenza in qualsiasi plasmide in qualsiasi posizione. (Riferimento: Bond SR & Naus CC. 2012. Nucl. Acids Res 40(problema del server Web): W209-W213)

primers4clades - è una pipeline per la progettazione di primer per PCR per l'amplificazione tra specie di nuove sequenze da DNA metagenomico o da organismi non caratterizzati appartenenti a linee filogenetiche specificate dall'utente. Implementa una strategia CODEHOP estesa basata su allineamenti multipli sia di DNA che di proteine ​​di geni codificanti e valuta le proprietà termodinamiche delle coppie di oligonucleotidi, nonché il contenuto di informazioni filogenetiche degli ampliconi previsti, calcolati dai valori di supporto del ramo delle filogenesi di massima verosimiglianza. Gli alberi visualizzati sullo schermo rendono facile indirizzare i primer ai cladi selezionati in modo interattivo. (Riferimento: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(problema del server Web): W95-W100).

TaxMan: ispeziona gli ampliconi dell'rRNA e le assegnazioni dei taxa - Nelle analisi del microbioma, spesso i database dei geni dell'rRNA vengono utilizzati per assegnare nomi tassonomici alle letture di sequenze. Il server TaxMan facilita l'analisi della distribuzione tassonomica delle tue letture in due modi. Innanzitutto, puoi controllare quali nomi tassonomici sono assegnati alle sequenze prodotte dai tuoi primer e quali taxa perderai. In secondo luogo, è possibile scaricare le sequenze di ampliconi prodotte con i lignaggi nell'intestazione FASTA. Ciò può comportare un'analisi molto più efficiente rispetto al tempo di esecuzione e all'utilizzo della memoria, poiché le sequenze di ampliconi sono considerevolmente più corte delle sequenze del gene rRNA a lunghezza intera. Inoltre, puoi scaricare un file di lignaggio che include i conteggi di tutti i taxa per i tuoi primer e per il riferimento utilizzato. (Riferimento: Brandt, B.W. et al. 2012. Ricerca sugli acidi nucleici 40:W82-W87).

Parametri fisico-chimici degli oligonucleotidi:

NetPrimer (Premier Biosoft International, USA) - A mio parere il miglior sito poiché ne fornisce uno con Tm, proprietà termodinamiche e tornanti e dimeri più stabili. MA ci vuole un po' di tempo per caricare il programma.

dnaMATE - calcola un consenso Tm per una sequenza di DNA corta (16-30 nts) utilizzando un metodo unito che si basa su tre diverse tabelle termodinamiche. Il valore di consenso Tm è una stima robusta e accurata della temperatura di fusione per brevi sequenze di DNA di applicazione pratica in biologia molecolare. I benchmark di accuratezza che utilizzano tutti i dati sperimentali disponibili indicano che gli errori di previsione Tm di consenso saranno entro 5 ºC dal valore sperimentale nell'89% dei casi. (Riferimento: A. Panjkovich et al. 2005. Nucl. Acidi Res. 33: W570-W572.).

OligoCalc - un calcolatore online delle proprietà degli oligonucleotidi - (Riferimento: W.A. Kibbe. 2007. Nucl. Acids Res. 35 (edizione del server Web): W43-W46)
Analizzatore Oligo 3.1 (Integrated DNA Technologies, Inc )
Calcolatore di massa Mongo Oligo v2.06
OligoValutatore (Sigma-Aldrich)
Strumento di calcolo oligo (Genescript, U.S.A.) - consente la modifica

Primer per PCR basati sulla sequenza proteica:

Se si dispone della sequenza proteica e si desidera la sequenza del DNA, i siti migliori sono la traduzione inversa da proteina a DNA o la parte di traduzione inversa della suite di manipolazione della sequenza. Se sei interessato a cambiare uno specifico amminoacido in un altro dovresti consultare Primaclade (Riferimento: Gadberry MD et al. 2005. Bioinformatica 21:1263-1264).

PCR e clonazione:

AMUSER (UNDNA automatizzato modificazioni con UTENTE clonazione) offre una progettazione rapida e semplice di primer PCR ottimizzati per vari tipi di ingegneria del DNA basata sulla clonazione UTENTE. La clonazione USER è un metodo veloce e versatile per l'ingegnerizzazione del DNA plasmidico. Questo strumento del server Web automatizza la progettazione di primer PCR ottimali per diverse applicazioni distinte basate sulla clonazione USER.Facilita l'assemblaggio del DNA e l'introduzione di praticamente qualsiasi tipo di mutagenesi sito-diretta progettando primer PCR ottimali per i cambiamenti genetici desiderati. (Riferimento: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Primer su scala genomica: (N.B. vedi anche la pagina JAVA per ulteriori programmi scaricabili)

La suite PCR (Klinische Genetica, Erasmus MC Rotterdam, Paesi Bassi) - questa è una suite di quattro programmi basati su Primer3 per la progettazione di primer genomici. Tutti offrono un controllo considerevole sulle proprietà del primer:

Overlapping_Primers: crea più prodotti PCR sovrapposti in una sequenza.
Genomic_Primers - progetta primer attorno agli esoni nella sequenza genomica. Tutto ciò di cui hai bisogno è un file GenBank contenente il tuo gene.
SNP_Primers - progetta primer attorno a ogni SNP in un file GenBank.
cDNA_Primers - progetta primer attorno a frame di lettura aperti. Carica semplicemente un file GenBank contenente i tuoi geni.

Set di primer sovrapposti:

Il software di offerta di due siti si basa sul programma Primer3 per la progettazione di set di coppie di primer per PCR sovrapposti - Multiple Primer Design con Primer 3 e Overlapping Primerset

PHUSER (Primer haiuto per UTENTE ) - La fusione Uracil-Specific Exision Reagent (USER) è una tecnica di recente sviluppo che consente l'assemblaggio di più frammenti di DNA in pochi semplici passaggi. PHUSER offre una progettazione rapida e semplice di primer ottimizzati per PCR garantendo la corretta fusione direzionale dei frammenti in un plasmide contenente una cassetta USER personalizzabile. I primer hanno una temperatura di ricottura simile (Tm). PHUSER evita anche sporgenze identiche, garantendo così il corretto ordine di assemblaggio dei frammenti di DNA. Tutti i possibili primer vengono analizzati individualmente in termini di contenuto di GC, presenza di clamp GC all'estremità 3', rischio di formazione di dimeri di primer, rischio di strutture secondarie intra-primer e presenza di stiramenti di poliN. (Riferimento: Olsen LR et al. 2011. Nucl. Acids Res. 39 (problema del server Web): W61-W70)

Primerize è un server Web per la progettazione di primer di assemblaggio PCR di sequenze di DNA. Primerize è ottimizzato per ridurre il mispriming dei confini dei primer, è progettato per sequenze fisse di problemi di RNA e ha superato test ampi e rigorosi. Questo efficiente algoritmo è adatto per un uso esteso come la libreria di mutagenesi massicciamente parallela. (Riferimento: Tian, ​​S., & Das, R. (2016) Quarterly Review of Biophysics 49(e7): 1-30).

Disegno di RNA interferente corto (siRNA):

Il piccolo RNA interferente (siRNA) guida la degradazione specifica della sequenza dell'mRNA omologo, producendo così cellule "knock-down". lo strumento di progettazione siRNA esegue la scansione di un gene bersaglio per le sequenze di siRNA candidate che soddisfano le regole regolabili dall'utente. Esistono diversi server:

siRNA Design Software: confronta gli strumenti di progettazione esistenti, inclusi quelli sopra elencati. Tentano anche di migliorare i principi MPI e gli strumenti esistenti mediante un algoritmo in grado di filtrare siRNA inefficaci. L'algoritmo si basa su alcune nuove osservazioni sulla struttura secondaria. ( Riferimento: S.M. Yiu et al. (2004) Bioinformatica 21: 144-151).

OligoWalk è un server online che calcola le caratteristiche termodinamiche dell'ibidizzazione senso-antisenso. Predice i cambiamenti di energia libera degli oligonucleotidi che si legano a un RNA bersaglio. Può essere utilizzato per progettare un siRNA efficiente mirato a una determinata sequenza di mRNA. (Riferimento: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - un server di previsione dell'efficacia di siRNA virale umano (Riferimento: Qureshi A et al. 2013. J Transl Med. 11:305).

I siRNA dicer-substrato (DsiRNA) sono RNA duplex a 27 mer sintetizzati chimicamente che hanno una maggiore potenza nell'interferenza dell'RNA rispetto ai siRNA tradizionali. RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Progettazione di siRNA RNAi vegetali efficaci e specifici con valutazione genica fuori bersaglio a livello di genoma.

DSIR è uno strumento per la progettazione di target siRNA (19 o 21 nt) e shRNA. (Riferimento: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Il programma Imgenex siRNA retriever è stato progettato per selezionare siRNA codificanti oligonucleotidi di DNA che possono essere clonati in uno dei vettori pSuppressor. È possibile accedere direttamente alla sequenza di input da un'adesione o sequenza Genbank fornita dal ricercatore.

siDRM è un'implementazione dei set di regole DRM per la selezione di siRNA efficaci. Gli autori hanno eseguito un'analisi aggiornata utilizzando l'approccio disjunctive rule merging (DRM) su un set di dati ampio e diversificato compilato da siRecords e implementato i set di regole risultanti in siDRM, un nuovo strumento di progettazione di siRNA online. siDRM implementa anche alcuni set di regole ad alta sensibilità e set di regole veloci, collegamenti a siRecords e utilizza diversi filtri per controllare gli effetti dannosi indesiderati, comprese le risposte immunitarie innate, gli effetti tossici delle cellule e le attività fuori bersaglio nella selezione dei siRNA. (Riferimento: Gong W et al. 2008. Bioinformatica 24:2405-2406).

siMAX siRNA Design Tool (Eurofins Genomic, Germania) - è un software sviluppato proprietario progettato per aiutarti a selezionare il siRNA più appropriato per i tuoi geni di interesse.

shRNA Designer (Biosettia Inc., USA) - Usa questo programma per progettare oligo shRNA compatibili con i nostri vettori SORT-A/B/C. Lo strumento di progettazione fornisce ai bersagli le maggiori possibilità di abbattere il tuo gene. Si prega di notare che solo un oligo è progettato in quanto palindromo.

siDESIGN Center (Horizon Discovery Ltd., Regno Unito) - è uno strumento di progettazione di siRNA avanzato e di facile utilizzo, che migliora significativamente la probabilità di identificare siRNA funzionali. Sono disponibili opzioni uniche per migliorare la specificità del bersaglio e adattare i progetti di siRNA per un design sperimentale più sofisticato.

Progettazione di primer per PCR in tempo reale:

RealTimeDesign (Tecnologie di bioricerca) - gratuito ma richiede la registrazione.

Progettazione di primer per PCR in tempo reale GenScript (TaqMan): è possibile personalizzare il potenziale intervallo di dimensioni dell'amplicone della PCR, Tm (temperatura di fusione) per i primer e le sonde, nonché per l'organismo. Puoi anche decidere quanti set di primer/sonda vuoi che lo strumento ti restituisca. È possibile utilizzare un numero di accesso GenBank come modello.

QuantPrime - è un programma flessibile per la progettazione di primer affidabile da utilizzare in esperimenti qPCR più grandi. Il framework flessibile è aperto anche per un semplice utilizzo in altre applicazioni di quantificazione, come la progettazione di sonde di idrolizzazione per qPCR e la progettazione di sonde oligonucleotidiche per quantitativi sul posto ibridazione. (Riferimento: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, USA)

Introduzione di mutazioni:

WatCut (Michael Palmer, Università di Waterloo, Canada) - prende un oligonucleotide e introduce mutazioni silenti in potenziali siti di restrizione in modo che la sequenza amminoacidica della proteina sia inalterata.

PrimerX - può essere utilizzato per automatizzare la progettazione di primer mutageni per la mutagenesi sito-diretta. È disponibile in due gusti (a) Primer Design basato sulla sequenza del DNA e (b) Primer Design basato sulla sequenza proteica

Primerize-2D - è progettato per accelerare la sintesi di grandi librerie di mutanti desiderati attraverso la progettazione e l'organizzazione efficiente dei primer. Il programma sottostante e l'interfaccia grafica sono stati testati sperimentalmente nel nostro laboratorio per domini RNA con lunghezze fino a 300 nucleotidi e librerie che comprendono fino a 960 varianti. (Riferimento: Tian, ​​S., & Das, R. (2017) Bioinformatica 33(9): 1405-1406).

Quando sei pronto per impostare la tua reazione PCR, vedi:

Calcolatore di titolazione PCR Box (Allotron Biosensor Corporation) - per calcolare le quantità di ciascun reagente da utilizzare in una titolazione box bidimensionale per PCR. Per le reazioni PCR standard, regolare il volume e modificare il numero di "riga" e "colonna" in "1", fare clic su tutti i pulsanti "in alto" o "in basso" e "fatto". Calcolatore di titolazione PCR (Angel Herráez Cybertory: laboratorio virtuale di biologia molecolare Universidad de Alcalá, Spagna) è un sito simile

Configurazione della miscela di reazione PCR (R. Kalendar, Università di Helsinki, Finlandia) - sito molto carino (richiede Java).

Ottimizzazione PCR (Bioline, Regno Unito) - molte condizioni

Presentazione del primer sulla sequenza del DNA:

Estrattore di sequenza (Paolo Stothard) - genera una mappa di restrizione cliccabile e una mappa di primer PCR di una sequenza di DNA (i formati accettati sono: raw, GenBank, EMBL e FASTA) offrendo un grande controllo sull'output. Sono anche mostrate le traduzioni delle proteine ​​e i confini introni/esoni. Usa Sequence Extractor per costruire costrutti di DNA in silicone.


ESPERIMENTO DI LABORATORIO: PROGETTAZIONE DI PRIMER A BASE VERDE SYBR® CON IL SOFTWARE PRIMER3

Sfondo

Chimica fluorescente di qPCR

Per quantificare la quantità di mRNA, DNA o cDNA in un campione, l'uso di segnali fluorescenti non specifici o sequenza-specifici può essere utilizzato insieme alla RT-PCR. Rilevamento specifico della sequenza (per esempio. TaqMan®, Moeg, Molecular Beacon e Scorpion) utilizzano sonde appositamente progettate che hanno fluorofori legati all'estremità 5' e quencher legati all'estremità 3' (Fig. 1). I fluorofori sono molecole (o parte di una molecola) che si eccitano in presenza di luce e rilasciano fluorescenza. Il quencher è una molecola che estingue la fluorescenza. Quando viene eseguita una reazione qPCR utilizzando un termociclatore specializzato (per esempio. BioRad iCycler), il modulo ottico del termociclatore seleziona la corretta lunghezza d'onda della luce e la riflette nel pozzetto in cui si trova la miscela di reazione PCR. Le molecole di fluoroforo si eccitano e diventano fluorescenti, quindi il sistema di rilevamento ottico del termociclatore misura e quantifica la quantità di emissione fluorescente presente in ciascun tubo. Ad esempio: un esperimento basato su TaqMan® richiederebbe l'aggiunta di una sonda fluorogenica insieme ai primer specifici della sequenza alla miscela di reazione PCR. La sonda è una sequenza oligonucleotidica progettata per ibridarsi con una regione interna del prodotto della PCR. Contiene il colorante reporter fluorescente (fluoroforo) attaccato alla sua estremità 5' e una porzione quencher attaccata all'estremità 3' (Fig. 1). Il fluoroforo e il quencher sono separati dalla lunghezza della sonda. La distanza è sufficientemente vicina da consentire alla fluorescenza del quencher di bloccare il segnale fluorescente del fluoroforo. Ciò impedisce il rilevamento del segnale fluorescente dalla sonda. Durante il ciclo di ricottura, la sonda si ricollegherà alla sua sequenza target tra il primer diretto e inverso. Finché la sonda è intatta, la fluorescenza del colorante reporter viene estinta, tuttavia, quando la DNA polimerasi estende il primer e replica lo stampo su cui è legata la sonda TaqMan®, l'attività esonucleasica della polimerasi taglia la sonda, rilasciando il reporter molecola e permettendo di rilevarne la fluorescenza. Il processo viene ripetuto durante ogni ciclo della PCR, aumentando il livello di fluorescenza man mano che le sonde aggiuntive vengono tagliate. Questi tipi di rilevamento sono ideali per rilevare polimorfismi a singolo nucleotide o per rilevare sequenze specifiche. Le sonde possono essere etichettate con diversi coloranti reporter che consentono all'utente di rilevare più di una sequenza specifica in un campione (questo è chiamato qPCR multiplex).

Chimiche fluorescenti verdi TaqMan® e SYBR®. TaqMan® (1) utilizza una sonda che consiste in una sequenza oligonucleotidica con una molecola reporter fluorescente 5′ (F) e un colorante quencher 3′ (Q). Finché la sonda è collegata, il segnale del colorante quencher (spesso un colorante colorato a lunghezza d'onda lunga) interrompe il segnale del fluoroforo (di solito un colorante colorato a lunghezza d'onda ridotta). Taq la polimerasi estende il primer (2) e replica il modello su cui è legata la sonda TaqMan®. L'attività esonucleasica di Taq la polimerasi (3) scinde la sonda, rilasciando il fluoroforo 5′ (colorante reporter) consentendo la fluorescenza. SYBR® Green intercala il dsDNA. Quando è libero nella miscela di reazione (1), emette solo piccole quantità di fluorescenza. Poiché i primer sono estesi da Taq, polimerasi e si verifica la replicazione del modello, più SYBR® Green viene intercalato nel filamento replicato (2). La fluorescenza aumenta man mano che i filamenti vengono replicati (3).

Il rilevamento non specifico utilizza coloranti fluorescenti come SYBR® Green I. Quando il colorante SYBR® Green viene aggiunto a una miscela di reazione PCR, si legherà immediatamente a qualsiasi dsDNA presente ed emetterà un segnale fluorescente che è 1.000 volte maggiore di SYBR® Green non legato [ 5 ] . Mentre il termociclatore ruota attraverso i suoi cicli (denatura→ricottura→estensione), vengono sintetizzati nuovi ampliconi da Taq polimerasi e sono immediatamente legati dal colorante SYBR® Green presente nella miscela. Il risultato è un aumento dell'intensità della fluorescenza che è direttamente proporzionale all'aumento del dsDNA. Questo tipo di sistema di rilevamento è la scelta più semplice ed economica per qPCR ma ha i suoi svantaggi in quanto non è selettivo. Possono risultare falsi positivi a causa dei dimeri del primer e dell'amplificazione non specifica. È quindi fondamentale progettare primer che riducano la possibilità di dimerizzazione e amplificazione non specifica.

Nozioni di base sulla progettazione di primer

Il successo di una PCR convenzionale da eseguire al massimo dipende dall'avere un buon modello di partenza, a Taq polimerasi e soluzione tampone di buona qualità e che progettano primer ben bilanciati tra due parametri: specificità ed efficienza. La specificità è importante perché si verificherà un errore di adescamento quando i primer sono progettati male. Ciò porta ad un'amplificazione non specifica delle sequenze trovate nel pool di modelli. L'efficienza è importante anche nella progettazione dei primer. Una coppia di primer efficiente produrrà un doppio aumento dell'amplicone per ogni ciclo della PCR. La maggior parte dei programmi software per la progettazione di primer sono preimpostati con parametri predefiniti per la PCR convenzionale. Ciò consente la selezione di coppie di primer che producono un rispettabile equilibrio tra specificità per la sequenza target e massima efficienza se utilizzate con un test PCR convenzionale, ma non sono necessariamente i migliori primer per una qPCR.

In un'applicazione qPCR basata su SYBR® Green, la specificità è molto importante. Per capirlo, è importante ricordare come funziona SYBR® Green. Il colorante SYBR® Green si legherà a qualsiasi dsDNA presente nella miscela di reazione, quindi l'amplificazione di prodotti non specifici produce dati non validi. Altri fattori da considerare sono la formazione di dimeri di primer e l'efficienza. I dimeri del primer possono aumentare la fluorescenza, determinando una quantificazione imprecisa dell'amplicone. L'efficienza (quanto bene si comportano i primer) di una reazione qPCR dovrebbe raggiungere il 90-100%. I primer efficienti aumentano la sensibilità della quantificazione e consentono la riproducibilità del dosaggio. I fattori che influenzano l'efficienza di una qPCR includono la lunghezza dell'amplicone e la qualità del primer. In breve, la chiave per sviluppare buoni primer a base di SYBR® Green è trovare una coppia di primer che siano molto specifici, non producono dimeri di primer, producono ampliconi corti e sono abbastanza efficienti da produrre risultati coerenti e riproducibili. Conoscere i parametri comuni, che possono essere regolati nella maggior parte dei software di progettazione di primer, può aiutare a raggiungere questo obiettivo.

Parametri comuni di Primer Design

Lunghezza primer

La lunghezza ottimale dei primer è generalmente accettata come 18-24 bp di lunghezza. Primer più lunghi impiegheranno più tempo per ibridarsi, più tempo per estendersi e più tempo per rimuovere, quindi producono meno amplicone.

Temperatura di fusione del primer (Tm)

Questa è la temperatura alla quale il 50% del primer e il suo complemento vengono ibridati. Per ottimizzare per qPCR trovare primer di lunghezza minima che hanno temperature di fusione (Tm) che sono comprese tra 59 e 68 °C, con un ottimale Tm di 63–64 °C. Anche il Tm della coppia di primer deve trovarsi entro 1 °C l'uno dall'altro. I primer dovrebbero anche avere un Tm che è superiore a Tm di qualsiasi struttura secondaria modello (trovata usando il software mFOLD, discusso più avanti).

Temperatura di ricottura

Le temperature ottimali di ricottura PCR in tempo reale sono 59 °C o 60 °C.

Taglia del prodotto

Un amplicone ideale dovrebbe essere compreso tra 80 e 150 bp. Se vengono utilizzati più geni, (cioè confrontando l'espressione relativa di diversi geni), la dimensione di tutti gli ampliconi dovrebbe essere vicina in lunghezza. Il rilevamento SYBR® Green produrrà una fluorescenza più intensa nei prodotti più grandi rispetto a quelli più piccoli (quindi tenere più prodotti vicini in lunghezza).

Mg++ Concentrazione

L'impostazione predefinita è zero sulla maggior parte dei software di progettazione di primer. Le miscele tampone SYBR® Green contengono da 3 a 6 mM di MgCl2.

Si ripete

Una ripetizione è una sequenza nucleotidica (un dinucleotide) che si ripete (per esempio. TCTCTCTCTC). Questi dovrebbero essere evitati perché promuovono il mispriming. Se inevitabile, il numero massimo dovrebbe essere di 4 di-nucleotidi.

Le sequenze sono nucleotidi ripetuti (per esempio. TAAAAAGC ha una corsa di 5 bp di adenina). Anche le corse dovrebbero essere evitate perché sono soggette a errori di adescamento. La corsa massima non dovrebbe essere superiore a 3-4 bp.

3′ Stabilità

Questo si riferisce al massimo ΔG delle 5 basi dall'estremità 3' dei primer. (ΔG è la Gibbs Free Energy, l'energia necessaria per rompere i legami presenti all'estremità 3′) Una maggiore stabilità 3′ migliorerà l'efficienza del primer.

Morsetto GC

Questo si riferisce al massimo ΔG delle 5 basi dall'estremità 5' dei primer. Spesso chiamato morsetto GC, la stabilità 5' si riferisce a quanto stabile l'estremità 5' è dovuta alla quantità di G o C presenti all'estremità 5' del primer. Avere da 1 a 2 morsetti GC è l'ideale, in quanto consente al primer di legarsi saldamente al filo del modello, rendendolo più specifico, tuttavia evitare più di 2 morsetti GC.

Esempio passo passo di progettazione di primer utilizzando il software Primer3

Uno dei programmi software di progettazione di primer più comunemente usati è Primer3 [ 7 ]. Può essere utilizzato per progettare primer per PCR, primer di sequenziamento e sonde di ibridazione. Primer3 ha molti parametri di input diversi che possono essere controllati per definire caratteristiche che consentono al software di progettare primer adatti a ciascun obiettivo. Questa sezione fornisce un esempio passo passo di come progettare primer utilizzando Primer3 e spiega le funzioni dei parametri più comunemente usati. (Nota: le seguenti descrizioni dei parametri di Primer3 si basano sul sito Web di Primer3 e in alcuni casi possono essere letterali.)

Passaggio 1: ottenere la sequenza in formato FASTA

Primer3 accetterà sequenze in FASTA, EMBL e altri formati. Per spiegare l'uso di Primer3, viene utilizzata una sequenza in formato FASTA del National Center for Biotechnology Information (NCBI). NCBI è un database pubblico finanziato dal governo di informazioni genomiche e di altro tipo relative alla biotecnologia. (Notare la Populus trichocarpa Il gene (di pioppo) deidrochinato deidratasi/shikimato deidrogenasi (DHQD4) utilizzato in questo esempio è il numero di accesso NCBI XM_002314438.1.)

Dal menu a discesa (sopra la casella di ricerca) seleziona "Nucleotide".

Nella casella di ricerca inserisci: XM_002314438.1. Fare clic su "Cerca".

Quando vengono visualizzati i risultati, fai clic su "Impostazioni di visualizzazione" che si trova nella parte superiore della pagina (sotto la barra di ricerca, a sinistra, nella parte superiore della pagina), seleziona FASTA quindi fai clic su "applica".

Opzionale: Apri un documento Word e copia la sequenza del formato FASTA su un foglio bianco. Ciò rende più facile controllare il modello per le strutture secondarie più avanti nell'esperimento.

Passaggio 2: utilizzo di Primer3

Sembra intimidatorio ma è facile da usare una volta acquisita familiarità con i parametri di ricerca. Il software Primer3 può essere utilizzato per progettare primer per tutti i tipi di PCR, quindi ha una moltitudine di opzioni. Dopo aver letto cosa fanno le opzioni, gli studenti vengono istruiti su come modificare le opzioni per progettare i primer per il gene DHQD4.

Istruzione: Vai al sito web di Primer3 all'indirizzo: http://frodo. wi.mit.edu/primer3/

Copia e incolla la sequenza in formato DHQD4 FASTA dal documento Word nella casella fornita nella pagina di progettazione del primer di Primer3 (Fig. 2).

Software online Primer3 per la selezione del primer. Immettere la sequenza del DNA in formato FASTA nella casella del nucleotide. Sopra, è stata inserita la sequenza Populus tricocarpa DHQD4. Gli identificatori NCBI (mostrati sopra come >gi|224107416|ref…mRNA) possono essere inseriti prima della sequenza ma non sono necessari.

Scegli il primer sinistro o usa il primer sinistro di seguito: Se questa opzione viene lasciata vuota, il programma Primer3 sceglierà il primer sinistro. Se, tuttavia, è già nota una sequenza di primer sinistro (o in avanti) e l'utente deve solo creare un primer destro (o inverso), la sequenza nota verrà inserita in questa casella.

Istruzione: per l'esempio del pioppo, lascialo vuoto.

Sonda di ibridazione Pick: Una sonda (per esempio. TaqMan®) non è richiesto nel rilevamento SYBR® Green, quindi lasciare vuoto questo campo. Quando si utilizza il rilevamento fluorescente basato su sonda, viene progettata una sonda insieme al set di primer. La selezione di questa opzione consente a Primer3 di fornire un elenco di sonde suggerite che funzionerebbero con il set di primer.

Istruzione: Per l'esempio del pioppo, lascialo vuoto.

Scegli il primer destro o usa il primer destro di seguito: Se questa opzione viene lasciata vuota, il programma Primer3 sceglierà il primer giusto. Se, tuttavia, è già nota una sequenza di primer destro (o inverso) e l'utente deve solo creare un primer sinistro (o in avanti), la sequenza nota verrà inserita in questa casella.

Istruzione: Per l'esempio del pioppo, lascialo vuoto.

ID sequenza: Un nome per il set di primer.

Istruzione: Per l'esempio Pioppo, inserisci il seguente nome: Populus trichocarpa DHQD4.

obiettivi: Se i primer devono essere progettati per una posizione "specifica" nella sequenza, l'utente può utilizzare le parentesi per indicare a Primer3 dove progettare i primer (per esempio. AA[TAGC]ACC) direbbe a Primer3 di progettare il primer attorno alle coppie di basi TAGC). Questa scelta è utile se si desidera progettare primer per un'area di sequenza specifica.

Istruzione: Per l'esempio del pioppo, saltare questa opzione.

Regioni escluse: Questa opzione è molto utile se è necessario evitare una certa parte della sequenza. Ad esempio, se i primer oligodT vengono utilizzati per eseguire la trascrizione inversa per creare cDNA, l'estremità 5' dell'mRNA (se è una sequenza molto lunga) non potrebbe essere rappresentata nel cDNA poiché il primer oligodT potrebbe cadere prima di raggiungerlo. In questo caso, è necessario evitare di progettare primer lungo l'estremità 5' e puntare invece all'estremità 3' della sequenza. Inoltre, questa opzione è molto utile se il software Primer3 fornisce più primer dalla stessa posizione (che non sono soddisfacenti) o fornisce primer che creano un amplicone che ha molte strutture secondarie (ne parleremo più avanti, quando discuteremo i valori di mFold ). Per evitare un'area, inserisci i valori come un elenco separato da virgole (per esempio: 81,6 dove 81 è la posizione bp in cui si desidera che Primer3 avvii questo comando e 6 è il numero di bp che segue il nucleotide in posizione 81 che dovrebbe evitare).

Istruzione: Per l'esempio del pioppo, lasciare vuoto.

Intervalli di dimensioni del prodotto: Questa è la dimensione del tuo amplicone. Un amplicone ottimale sarebbe ∼120 bp di lunghezza. Generalmente, sono accettabili ampliconi di 80–200 bp, tuttavia, ampliconi più lunghi danno risultati qPCR meno efficienti perché è incorporato più SYBR® Green.

Istruzione: Per l'esempio del pioppo:

Immettere: 80–150 100–200 (questo indica a Primer3 di cercare prima i primer che produrranno ampliconi tra 80 e 150 bp, quindi cercare i primer che produrranno ampliconi tra 100 e 200 bp.

Numero da restituire: Questo è il numero di set di primer che Primer3 restituirà. Questo numero è a discrezione dell'utente.

Istruzione: Per l'esempio Pioppo, inserisci 10.

Massimo 3Stabilità: Questo si riferisce al massimo ΔG delle 5 basi dall'estremità 3' dei primer. (ΔG è l'energia libera di Gibbs G—l'energia necessaria per rompere i legami presenti all'estremità 3′) Una maggiore stabilità 3′ migliorerà l'efficienza del primer. Più alto è questo numero, più stabile è l'estremità 3′. (Nota: l'utente potrebbe dover modificare questo numero per ottenere primer adatti.) Spesso l'equilibrio tra efficienza e specificità è reso più difficile a causa della formazione di strutture secondarie.

Istruzione: Per l'esempio del pioppo lasciare il valore a 9 (per restituire primer più efficienti).

Mispriming con ripetizione massima: Si ripete (per esempio. AATATATA) può causare errori di priming (risultato di un primer che si lega a un modello involontario). Alcuni eucarioti (umani, drosofila e topi per esempio) hanno segmenti ripetuti noti per il mispriming. Poiché questo è comune, sono stati creati database (chiamati librerie) di sequenze note per causare errori di priming. Questa opzione consente a Primer3 di evitare aree di noto errore di adescamento durante la progettazione dei primer. Se i primer qPCR vengono progettati per sequenze umane, di topo o di moscerino della frutta, è necessario scegliere prima una libreria. Per scegliere una libreria, controlla quale specie viene utilizzata dalla finestra a discesa (sopra la casella di input della sequenza nella parte superiore della pagina). Quindi inserire il valore massimo nella casella "Ripetizione errore di caricamento max". Questo valore è la somiglianza ponderata massima consentita del primer individuale (diretto o inverso) con tutti i nucleotidi ripetuti noti che causano il mispriming. Per ridurre la probabilità di errori di priming, lasciare il numero a 12 o aumentare il numero. Poiché questo esperimento utilizza una sequenza di alberi di pioppo, Primer3 non avrà una libreria di mispriming a cui accedere, quindi lascia il valore a 12. Alcuni utenti esperti di computer creano il proprio codice per consentire a Primer3 di accedere ai database di mispriming che hanno creato, ma questa tecnologia è al di sopra dello scopo di questo esperimento e non sarà discusso.

Istruzione: Per l'esempio del pioppo, lasciare il valore a 12.

Accoppiare il mispriming con ripetizione massima: Questo valore è la somiglianza ponderata massima consentita della coppia di primer (sia in avanti che inversa) a tutti i nucleotidi ripetuti noti che causano il mispriming. Per ridurre la probabilità di errori di priming, lascialo a 24 o aumenta il numero.

Istruzione: Per l'esempio del pioppo, lasciare il valore a 24.

Mispriming massimo del modello: Il mispriming è il risultato di un primer che si lega a un modello non intenzionale con conseguente amplificazione. Questa opzione controlla i singoli primer per verificare la probabilità che si aprano male in un'altra area della sequenza fornita. Il mispriming del modello deve essere evitato nella qPCR, altrimenti durante l'amplificazione verrà prodotta una miscela di ampliconi del prodotto previsto e un prodotto non specifico. Lasciare il valore a 12 o aumentare il numero per ridurre la probabilità di errori di adescamento. (Nota: quando viene eseguita una qPCR basata su SYBR® Green, è necessario utilizzare un controllo senza templato (NTC) e il termociclatore deve essere programmato per generare una curva di fusione per rilevare i prodotti secondari. Se sono presenti picchi aggiuntivi nella curva di fusione , ma non viene rilevato alcun amplicone nell'NTC, i primer devono essere riprogettati poiché questi picchi indicano che vengono amplificati prodotti non specifici).

Istruzione: Per l'esempio del pioppo, lasciare il valore a 12.

Accoppia il modello massimo di Mispriming: Questa opzione controlla le coppie di primer per la probabilità che si aprano male sul modello fornito. Lascialo a 24 o aumenta il numero per ridurre la probabilità di errori di adescamento.

Istruzione: Per l'esempio del pioppo, lasciare il valore a 24.

Condizioni Generali di Prelievo Primer: Queste sono opzioni generali che l'utente può impostare per selezionare i primer.

Dimensione del primer: La specificità può essere controllata trovando un equilibrio tra la lunghezza del primer e la temperatura di ricottura della PCR. La lunghezza ottimale dei primer è generalmente accettata come 18-28 bp di lunghezza. Se si utilizzano sonde (per esempio. TaqMan®) in una PCR multiplex, aumentare questa lunghezza fino a 35 bp. Per ottimizzare per SYBR® Green qPCR trovare primer di lunghezza minima che hanno temperature di fusione (Tm) che sono comprese tra 62 e 67 °C, con un ottimale Tm di 63°C.

Istruzione: Per il valore minimo, inserisci 20 per Ottimale, inserisci 25, Per Massimo, inserisci 28

Primer Tm: Questa è la temperatura alla quale il 50% del primer e il suo complemento modello vengono ibridati. Prova a progettare primer con temperature di fusione comprese tra 62 e 67 °C, con un ottimale Tm da 62 °C a 64 °C. Il Tm la differenza tra i primer diretti e inversi non deve essere superiore a 1–2 °C.

Istruzione: Minimo, inserisci 60, Ottimo, inserisci 64, Massimo, inserisci 70

Massimo Tm Differenza, inserisci 2

Tabella dei parametri termodinamici: Primer3 utilizza queste formule per calcolare la temperatura di fusione. Il valore consigliato è SantaLucia1998.

Istruzione: Per l'esempio Pioppo, impostare su SantaLucia1998.

Prodotto Tm: Questa è la temperatura alla quale il 50% dell'amplicone è ssDNA. La temperatura varia a seconda del contenuto GC del modello. Idealmente, un'area mirata sul modello avrebbe un contenuto GC del 50%.

Istruzione: Per l'esempio del pioppo, impostare ottimale su 50.

Primer GC: Questa è la percentuale minima e massima di guanina e citosina (GC) consentita. Il contenuto di GC dei primer viene utilizzato per determinare la temperatura di fusione del primer, che può essere utilizzata per prevedere la temperatura di ricottura. La temperatura di fusione dei primer è generalmente da 3 a 5° al di sotto della temperatura di ricottura. Idealmente, i primer qPCR dovrebbero ricottura a 59-60 ° C. (Nota: la maggior parte delle soluzioni master mix SYBR® Green contiene quantità specifiche di tampone (sale) e MgCl2, che alterano la temperatura di fusione del primer.)

Istruzione: Per l'esempio Pioppo: Minimo 35, Ottimo 65, Massimo = 80.

Max auto gratuito: I primer non dovrebbero essere autocomplementari o complementari l'uno all'altro. I primer che sono autocomplementari formano autodimeri o strutture a forcina. Poiché il colorante SYBR® Green interagirà con qualsiasi struttura di DNA a doppio filamento, questo valore dovrebbe essere impostato il più basso possibile. Inizialmente, impostare il valore su 2. Se Primer3 non fornisce set di primer, aumentare il valore con incrementi di 1 e inviare nuovamente, ripetere se necessario.

Istruzione: Per l'esempio del pioppo, impostare il valore su 4.

Massimo 3Auto-gratuito: Poiché le polimerasi aggiungono basi al 3 estremità dell'oligonucleotide, il 3- le estremità dei primer non dovrebbero essere complementari l'una all'altra, poiché si verificheranno i dimeri dei primer. A volte questo non può essere evitato. Tuttavia, prestare particolare attenzione alla complementazione tra primer a 2 o più basi al 3 estremità dei primer poiché questi tendono a formare i primer più facilmente (vedi Fig. 3). Impostare il valore basso (per esempio. 2 o 3) e aumentare con incrementi di 1 se Primer3 non fornisce un elenco di primer.

Istruzione: Per l'esempio Pioppo, impostare il valore su 3.

N. massimo: Questo è il numero massimo di basi sconosciute che Primer3 potrebbe considerare nella realizzazione dei primer. Molti geni, EST (Expressed Sequenced Tags) e cDNA nella GeneBank dell'NCBI contengono basi sconosciute (N). Il simbolo N viene fornito come "segnaposto" quando il sequenziamento non può determinare il nucleotide (G,C,T o A) presente in una determinata posizione nella sequenza del gene (o cDNA). Per evitare un'amplificazione non specifica, impostare questo valore su zero.

Istruzione: Per l'esempio del pioppo, impostare su 0

Max Poly-X: Il numero massimo di ripetizioni mononucleotidiche consentite nel primer. Ripetizioni mononucleotidiche lunghe (per esempio. AAAAAAA) può favorire il mispriming e dovrebbe essere evitato. Come regola generale, esecuzioni di 3 o più C o G al 3 le estremità dei primer dovrebbero essere evitate, poiché la loro presenza può favorire il mispriming nelle sequenze ricche di C o C.

Istruzione: Per l'esempio del pioppo, impostare questo valore su 3.

Penalità all'interno del bersaglio e Penalità all'esterno del bersaglio: Utilizzato se il primer deve essere progettato per sovrapporsi a una regione (per esempio. giunzioni interstiziali). “Se il primer fa parte di una coppia che copre un target e si sovrappone al target, moltiplica questo valore per il numero di posizioni nucleotidiche per cui il primer si sovrappone al target (unico) per ottenere la 'penalità di posizione' (dal sito web di Primer3 ). Questo parametro consente a Primer3 di includere la sovrapposizione del primer con l'area mirata della sequenza come termine nella funzione obiettivo.

Istruzione: L'impostazione predefinita è ok.

Primo indice di base: Questo parametro indica a Primer3 quale tipo di indice di programmazione è la prima base nella sequenza di input. GenBank (NCBI) utilizza l'indicizzazione basata su uno.

Istruzione: L'impostazione predefinita va bene.

Morsetto GC: Definisce i numeri specifici di Gs e Cs al 3 fine di entrambi i primer sinistro e destro. Anche se vuoi posizionare Gs o Cs sul 3 estremità del tuo primer, non più di 2-3 G e C dovrebbero essere nelle ultime 5 basi alle 3 fine del primer.

Istruzione: Il valore predefinito 0 va bene.

Conc. di cationi monovalenti: Questa è la concentrazione millimolare di sale KCl (il più delle volte) nella PCR. Lasciare a 50 μM, a meno che non ci sia un motivo per cui hai aggiunto più sale.

Istruzione: L'impostazione predefinita è ok.

Formula di correzione del sale. Fattori comeG e Tm influenzare le prestazioni della PCR e alterare l'efficienza delle coppie di primer. Come la Tm di una sequenza di DNA dipende dalla lunghezza, dalla sequenza, dall'ambiente ionico circostante e dal pH dell'ambiente, è importante valutare la termodinamica di dissociazione e associazione dei filamenti di nucleotidi durante la PCR. Primer3 utilizza formule basate sul modello del vicino più prossimo con correzione del sale. La formula del sale SantaLucia 1998 è preferita da Primer3. Questa formula è progettata per consentire la correzione del sale indipendentemente dalla sequenza ma dipendente dalla lunghezza dell'oligonucleotide.

Istruzione: Per il campione Pioppo, selezionare SantaLucia 1998.

Conc. di cationi bivalenti: Questa è la concentrazione di sali bivalenti (solitamente MgCl 2+) presenti nella miscela PCR. Le miscele SYBR® Green di solito contengono ∼3 mM.

Istruzione: Passa a 3,5 mM (per regolare MgCl in SYBR Green Supermix)

Conc. di dNTP: Di solito si consiglia una concentrazione di dNTP di 200 μM affinché la Taq polimerasi funzioni in modo efficiente in una PCR convenzionale, dove MgCl2 le concentrazioni sono 1,5 mM. L'aumento delle concentrazioni di dNTP può inibire le reazioni di PCR intrappolando il Mg libero. Alcuni master mix SYBR® Green vengono preparati con taq, KCL, MgCl2e dNTP già nel mix. Queste miscele sono state testate in laboratorio per offrire le massime prestazioni.

Istruzione: Per l'esempio del pioppo, utilizzare 0,20 mM

Ricottura Oligo Concentrazione: Utilizzato per calcolare la temperatura di fusione degli oligo, questa è la concentrazione nanomolare degli oligo di ricottura nella PCR. Poiché il valore dipende dalla quantità di oligo e dalla quantità di stampo, è difficile calcolare questo valore (dato che il cDNA viene utilizzato come stampo). Primer3 afferma che l'impostazione predefinita (50 nM) funziona bene per la maggior parte delle applicazioni.

Istruzione: Per l'esempio del pioppo, il valore predefinito è ok.

Pesi di penalità della funzione obiettivo per i primer: La sezione dei pesi delle penalità consente agli utenti di Primer3 di modificare i criteri utilizzati da Primer3 per selezionare i migliori set di primer. Se non vengono assegnati pesi di penalità, il programma utilizzerà le informazioni che l'utente ha fornito alle specifiche "General Primer Picking" e classificherà ciascun set di primer in base a tali condizioni. Usando i pesi di penalità, l'utente dice a Primer3, "questo criterio è più importante di un altro". Gli utenti inseriscono i pesi delle penalità nei valori di 0, 1, 2, 3, ecc. dove 0 è meno importante. Ad esempio, si potrebbe decidere che i dimeri dei primer sono una preoccupazione maggiore degli ampliconi secondari. Quindi, l'opzione Self Complementary potrebbe essere impostata su 3 e Template Mispriming su 2. Alcuni parametri hanno due caselle (Lt e Gt). Questa opzione minore di (Lt)/maggiore di (Gt) consente una maggiore flessibilità nella raccolta dei primer. Ad esempio, se l'utente ha specificato in "Condizioni generali per la scelta del primer" che la dimensione del primer (dimensione) deve essere compresa tra 18 bp e 27 bp, tutti i primer considerati saranno penalizzati se sono inferiori a 18 bp o superiori a 27 pb. Un utente potrebbe dare una penalità di 2 per primer inferiori a 18 bp e una penalità di 0 per primer maggiori di 27 (se sono accettabili primer più lunghi).

Istruzione: Per l'esempio del pioppo, cambia i seguenti pesi di penalità:


Quando si progettano i primer quanto è importante il morsetto GC? - Biologia

Progettazione di primer per PCR

Il Primer Designer è dotato di un'interfaccia in tempo reale potente, ma estremamente semplice, per consentire la rapida identificazione dei primer ideali teorici per le reazioni PCR. Le coppie di primer vengono calcolate dalle regioni target impostate, quindi vagliate rispetto a una serie di parametri per massimizzare l'efficienza di priming per una PCR senza problemi.

Il principale Primer Designer form consiste essenzialmente di due griglie e alcuni controlli dei parametri. Le griglie mostrano tutti i possibili primer in avanti (lato sinistro) e inverso (lato destro) che sono conformi ai parametri impostati e rientrano nelle regioni target specificate per ciascun primer. Noterete subito che, rendendo più stringenti le condizioni di selezione dei primer, la lista dei possibili primer diminuirà. Questo processo di screening in tempo reale consente di restringere molto rapidamente l'elenco dei potenziali primer e di selezionare quelli che meglio si adattano alle esigenze del tuo esperimento.

Le regioni da cui vengono scelti i primer possono essere visualizzate e regolate sul Mappa sequenziale interattiva. Le regioni sono rappresentate da riquadri delineati, di colore verde per i primer diretti e viola per i primer inversi. Le regioni possono essere spostate trascinandole con il mouse e le loro dimensioni possono essere regolate facendo clic sui loro bordi e allungandole alla dimensione desiderata.Per una regolazione precisa della posizione o delle dimensioni della regione, selezionare semplicemente l'intera casella o il bordo appropriato, quindi utilizzare le frecce sinistra e destra per spostare la selezione nell'esatta posizione desiderata. Le regioni di selezione dei primer sono mostrate anche nel Editor di sequenze come regioni ombreggiate verde chiaro e viola.

Le posizioni dei primer diretti e inversi attualmente selezionati nelle tabelle del modulo Primer Designer sono mostrate sulla Mappa sequenza interattiva come barre verdi e viola continue e sull'Editor sequenza come aree verdi e viola scure.

Regolazione dei parametri di selezione del primer

Vari parametri possono essere regolati sul modulo Primer Designer, consentendo di specificare come verranno schermati i primer. Sebbene le impostazioni predefinite dei parametri siano adeguate per una tipica reazione PCR, sarà probabilmente necessario modificarle in una certa misura a seconda della natura dell'esperimento. I parametri e le loro funzioni sono descritti nella tabella seguente:

ParametroFunzione
Gamma di lunghezzaSpecifica la lunghezza minima e massima dei primer.
%Gamma GCSpecifica la percentuale minima e massima del contenuto di GC nel primer. I primer efficienti hanno generalmente % GC di circa 50.
Gamma TmSpecifica la temperatura di fusione minima e massima (in gradi Celsius) del primer, calcolata con il metodo Nearest Neighbor (vedi sotto).
3' di stabilità finaleDetermina il D G delle ultime 5 basi a 3'. Un'estremità 3' instabile (meno DG negativo) risulterà in un adescamento meno falso.
Stabilità terminale 5' (morsetto GC)Determina il DG G delle ultime 5 basi all'estremità 5'. Un'estremità 5' stabile (più DG negativo) risulterà in un legame più efficiente e specifico al modello.
D G DimeroSpecifica il DG minimo tollerabile per la formazione del dimero del primer.
D G ForcinaSpecifica il DG minimo tollerabile per la formazione di forcine di primer.

Nelle funzioni sopra, tutti i valori DG sono calcolati secondo il metodo del vicino più prossimo (Breslaur et al., 1986).

Ci sono tre metodi comunemente usati per calcolare il Tm. L'espressione utilizza il metodo più accurato, Il vicino più prossimo. Le formule e i riferimenti per i diversi metodi sono riassunti nella tabella seguente:


Progettazione di primer per PCR

Progettazione di primer per PCR
Considerazioni generali sulla progettazione. Assicurati che:

  • La lunghezza del primer è tra 15-30 bp omologa alla sequenza di DNA bersaglio. Suggerisco di iniziare con primer da 20-25 bp.
  • La Tm di ogni primer è compresa tra 55-65 °C
  • Il contenuto di GC di ciascun primer è compreso tra il 40-60%
  • I Tm di entrambi i primer sono molto simili, cioè entro

Considerazioni specifiche per le parti Golden Gate

Considerazioni specifiche per le parti BioBrick

    • Assicurarsi che il DNA genomico da amplificare non contenga siti EcoRI, PstI, SpeI o XbaI.
    • Di solito creo un prodotto PCR che ha un sito XbaI a monte della parte e siti SpeI, NotI e PstI a valle della parte.
    • La parte Biobrick inizia con un codone di inizio (ATG) e termina con due codoni di stop consecutivi (TAATAA).
    • Quindi il primer forward dovrebbe essere della forma:

    5′ CCTTTCTAGAG (15-20 bp del filamento codificante, partendo da ATG) 3′

    e il primer inverso dovrebbe essere della forma:

    5′ AAGG’CTGCAGCGGCCGCTACTAGT’A (15-20 bp complemento inverso, TTATTA iniziale) 3′

    Qui ci sono quattro nucleotidi (in corsivo) che fiancheggiano i siti di restrizione (in grassetto) tali distanziatori sono necessari per consentire agli enzimi di restrizione di tagliare correttamente.

    Considerazioni specifiche per le parti BioFusion

    • Assicurarsi che il DNA genomico da amplificare non contenga siti EcoRI, PstI, SpeI o XbaI.
    • Di solito creo un prodotto PCR che ha un sito XbaI a monte della parte e siti SpeI, NotI e PstI a valle della parte.
    • L'inserto per il primer forward non inizia con TC (oppure si forma un sito DAM I (GATC) e XbaI non può tagliare).
    • La costruzione Biofusion non inizia con un codone di inizio, né finisce con un codone di stop.
    • Quindi, il primer forward dovrebbe essere della forma:

    5′ ”CCTT””’TCTAGA”’ (15-20 bp del filamento di codifica) 3′
    e il primer inverso dovrebbe essere della forma:
    5′ ”AAGG””’CTGCAGCGGCCGCTACTAGT”’ (15-20 bp complemento inverso) 3′
    Qui ci sono quattro nucleotidi (in corsivo) che fiancheggiano i siti di restrizione (in grassetto) tali distanziatori sono necessari per consentire agli enzimi di restrizione di tagliare correttamente.

    • Nota: se non è possibile realizzare un buon set di primer con le regioni fiancheggianti sopra descritte, provare a cambiare le prime 4 basi – che sono esterne al sito di restrizione – di ciascun primer, ad es. <br>5′ ”AAGG””’TCTAGA”’ (15-20 bp del filamento di codifica) 3′ <br>
    • Nota: se non sei ancora in grado di ottenere un buon set di primer, prova a utilizzare un set completamente diverso di regioni fiancheggianti per migliorare i primer. Ad esempio, puoi anche utilizzare un prodotto PCR che ha i siti EcoRI, NotI e XbaI a monte della tua parte, mentre il sito SpeI è a valle della tua parte.

    In questo caso, il primer diretto sarebbe della forma: 5′ ”CCTT””’GAATTCGCGGCCGCATCTAGA”’ (15-20 bp complemento al filamento codificante)3′ e il primer inverso dovrebbe essere del forma: <br> 5′ ”AAGG””’ACTAGT”’ (15-20 bp complemento al filamento di codifica) 3′.

    Progettazione di primer utilizzando Vector NTI
    Un modo semplice per progettare i primer è utilizzare Vector NTI.


    Quando si progettano i primer quanto è importante il morsetto GC? - Biologia

    Per modelli di grandi dimensioni come BAC, PAC e cosmidi che possono avere livelli più elevati di impurità, si consiglia l'uso del primer SP6long invece del primer SP6 standard, che ha una Tm marginalmente bassa. Il primer SP6long è più lungo di quattro basi (quindi controlla la compatibilità con i tuoi vettori) ma funziona bene per modelli di grandi dimensioni quando il primer SP6 più corto fallisce.

    Considerazioni sulla progettazione del primer

    • Una temperatura di fusione (Tm) nell'intervallo da 50 C a 65 C
    • Assenza di capacità di dimerizzazione
    • Assenza di una significativa formazione di tornanti (>3 bp)
    • Mancanza di siti di priming secondari
    • Legame specifico da basso a moderato all'estremità 3' (evitare un alto contenuto di GC per evitare errori di adescamento)

    Infine, tieni presente che nessuna serie di linee guida sarà sempre in grado di predire con precisione il successo di un primer. Alcuni primer potrebbero fallire senza una ragione apparente e i primer che sembrano essere scarsi candidati potrebbero funzionare bene.


    BatchPrimer3 è un altro software di progettazione di primer basato su Primer3 disponibile gratuitamente online. C'è un'enorme quantità di sottotipi di primer da progettare, inclusi primer generici per PCR. BatchPrimer3 richiede l'inserimento o il caricamento di una sequenza FASTA. È disponibile anche una selezione intermedia di parametri del primer da modificare.

    Gli strumenti di progettazione Primer di Eurofins Genomics utilizzano il programma Prime+ del pacchetto GCG Wisconsin, originariamente scritto da Irv Edelman. Tutto ciò che serve è una sequenza di destinazione, che viene copiata e incollata nel programma, quindi hai la possibilità di modificare i parametri di progettazione. L'output include anche una temperatura di ricottura suggerita da utilizzare per ciascuna coppia di primer.

    Hai suggerimenti gratuiti per il software di progettazione di primer per PCR da aggiungere all'elenco? Lascia un commento qui sotto con la tua scelta preferita e sarò sicuro di aggiornare l'elenco.


    Guarda il video: come rimuovere la buccia darancia dalla vernice (Febbraio 2023).