Informazione

Esistono eucarioti senza introni?

Esistono eucarioti senza introni?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Questa domanda sulla funzione degli introni nei geni eucariotici mi ha fatto pensare: so che più organismi basali hanno introni più piccoli e meno esoni uniti alternativamente rispetto ai mammiferi. Ma ci sono eucarioti i cui genomi non hanno affatto introni?


Non credo. Non ho mai incontrato un eucariota che non ha introni anche se ci sono alcuni geni che non contengono introni. Alcuni eucarioti come i ciliati in realtà contengono altre regioni intergenetiche non introniche che sembrano non funzionali. Queste sono chiamate sequenze esistenti internamente e vengono rimosse dal micronucleo attivo della linea germinale prima di andare a formare il micronucleo trascrizionalmente attivo. È interessante notare che gli introni sono presenti anche in questi organismi e sono presenti sia nel micro che nel macronucleo. Questi introni sono uniti come da manuale. Credo che uno degli organismi in cui sono stati scoperti gli introni fosse in Tetrahymena thermophila con l'introne nella sequenza dell'rDNA.


Perché i genomi dei procarioti mancano di geni con gli introni elaborati dagli spliceosomi?

Fino al 1977 pensavamo che i geni eucariotici fossero come quelli dei procarioti, cioè sequenze continue che iniziano con un codone di iniziazione (ATG), seguito da un quadro di lettura aperto, sempre multiplo di tre basi (codoni), e dal messaggio (mRNA) interrotto quando è stato raggiunto un codone di stop (TAA, TAG o TGA). Questo paradigma, che storicamente sembrava del tutto logico, cambiò radicalmente quando due gruppi, guidati da Sharp e Roberts (Berget et al. 1977 Chow et al. 1977), scoprirono che (almeno alcuni) geni codificanti per proteine ​​eucariotiche erano interrotti da geni non codificanti. sequenze ed eliminato dall'mRNA maturo (tradotto) prima della traduzione. Quindi, Gilbert (1978) ha coniato il concetto di esoni (regioni del DNA codificante rimaste nell'mRNA) e introni (le regioni che vengono eliminate dall'mRNA maturo, e quindi non sono presenti nelle proteine ​​codificate).

Oggi non ci sono dubbi che questa scoperta sia stata una rivoluzione nella genetica. Non solo ha messo in discussione la nostra precedente definizione di cosa sia un "gene", ma ha portato a scoperte e concetti come lo splicing (cioè come vengono eliminati gli introni e gli esoni vengono messi insieme per creare l'mRNA maturo), lo splicing alternativo (come i diversi esoni dallo stesso “gene” possono essere combinati per formare proteine ​​diverse), o alla grande scoperta che alcuni RNA, una volta trascritti, possono eliminare da soli gli introni, meccanismo noto come autosplicing (vedi, ad esempio, Bass e Cech 1986 Cech e Basso 1986 Guerrier-Takada e Altman 1986). A sua volta, la scoperta dell'autosplicing non solo ha rafforzato l'idea del “mondo a RNA” (per una recensione si veda Lehman 2015) ma ha eliminato, per sempre, l'idea unanime del tempo che le proteine ​​fossero le uniche molecole catalitiche.

Pertanto, la presenza di introni nella maggior parte dei geni eucarioti ha messo in discussione la maggior parte dei nostri concetti sui geni, la loro regolazione, la loro evoluzione, cos'è un enzima... e ultimo, ma non meno importante, perché ci sono solo probabilmente meno di 20.000 geni nel genoma umano mentre un organismo "semplice" come Escherichia coli ne ha solo circa 4000. In altre parole, gli introni e il modo in cui vengono eliminati dagli mRNA maturi ha cambiato i nostri concetti sulla biologia molecolare e sull'evoluzione.

Ma visto quanto detto nelle righe precedenti (che ovviamente non pretendono di essere una recensione sull'argomento), c'è un problema che, a nostro avviso, merita una certa attenzione. Come noto, i procarioti mostrano un'enorme divergenza e differenti vie metaboliche e stili di vita e occupano tutti gli ambienti conosciuti. Allora, perché non hanno mai sviluppato introni elaborati da spliceosomi? Nelle prossime righe proporremo una spiegazione.

Naturalmente il più semplice è quello dato che nei procarioti trascrizione e traduzione sono accoppiate, un tale sistema dovrebbe essere uno svantaggio dal punto di vista evolutivo. Inoltre, dovrebbero essere presenti gli introni. Ma non ci sono prove che questo sia stato il caso. Finora niente di nuovo. Ma c'è un punto che, a nostro avviso, sembra molto importante.

Come è noto, il moderno spliceosoma, nella sua forma più semplice, è un complesso di non meno di dieci diverse proteine ​​e diversi RNA. Immaginiamo che questo complesso, o anche il più semplice, si sia evoluto in un procariota. E per qualche motivo, che potrebbe essere dovuto alla combinazione di geni diversi in nuovi geni più lunghi, è diventato fisso (o l'esistenza o gli introni primitivi). È difficile immaginare uno scenario del genere, ma supponiamo che sia effettivamente accaduto, ad esempio, "mettendo insieme" diversi pezzi di geni dallo stesso operone. Questo potrebbe essere un vantaggio, perché diversi pezzi di diversi mRNA potrebbero combinarsi per produrre nuove proteine ​​con funzioni diverse, ma correlate. Non esiste alcun vincolo biologico che possa impedirlo. Inoltre, dovrebbe essere un nuovo modo per creare nuovi geni e, di conseguenza, nuove funzioni. Sottolineiamo che questo scenario è difficile da immaginare solo perché (per quanto ne sappiamo) non si è verificato. Ma se ci fosse un esempio, non dovrebbe essere una grande sorpresa.

Tuttavia a nostro avviso ciò non è avvenuto per un altro motivo: una delle forze principali nell'evoluzione dei procarioti è il trasferimento genico orizzontale (vedi, ad esempio, Puigbò et al. 2010). Come è noto, affinché un gene (o un gruppo di geni) possa essere fissato devono essere soddisfatte diverse “fasi” biochimiche ed evolutive, tra le quali: (a) essere trasferito come un'unità, (b) portare (o essere integrato vicino) un promotore, (c) per non disturbare le normali funzioni del recettore e (d) per conferire un vantaggio selettivo.

Molto probabilmente, un putativo “spliceosoma primitivo” (PS) non era così complesso come quello moderno. Ma in ogni caso dovrebbe essere una particella piuttosto complessa, composta da diverse proteine ​​e RNA. Perché sia ​​trasferito con successo, sono necessarie diverse condizioni: (a) Tutti i componenti del PS dovrebbero essere trasferiti contemporaneamente, il che è difficile da immaginare, perché dobbiamo postulare un grande "operone PS", che probabilmente non esisteva come tale, e quindi, è necessario invocare più eventi, il che è molto improbabile. (b) Gli introni non possono essere possibili nel recettore (altrimenti dovrebbe avere un PS), e se non esistessero, un meccanismo PS molto probabilmente dovrebbe essere estremamente dannoso per il recettore ed eliminato dalla popolazione, a causa del non- adattamento dei geni all'azione dello xeno-PS. (c) Anche se a e b venissero ignorati (il che ovviamente è più che improbabile), i nuovi geni acquisiti da HGT dal recettore di PS dovrebbero essere influenzati negativamente dal PS acquisito. Quindi, nuovi eventi di HGT dovrebbero essere eliminati dal recettore, eliminando, di conseguenza, una delle principali forze nell'evoluzione.

Quindi, concludiamo che allo stesso modo in cui HGT è stato uno dei principali fattori che hanno contribuito a fissare il codice genetico universale come postulato da Vetsigian et al. (2006), potrebbe essere una forza importante che inibisce la comparsa (e la fissazione) degli introni elaborati dagli spliceosomi tra i procarioti.


Regolazione genica negli eucarioti

Facciamo uno studio approfondito della regolazione genica negli eucarioti. Dopo aver letto questo articolo imparerai a: 1. Modifica della cromatina 2. Controllo della trascrizione da parte degli ormoni 3. Regolazione del trattamento dell'mRNA 4. Controllo della durata di mRNA 5. Amplificazione genica 6. Regolamento Post Traduzione e 7. Silenziamento genico post-trascrizione.

Introduzione alla regolazione genica:

L'espressione dei geni può essere regolata negli eucarioti da tutti i principi come quelli dei procarioti. Ma ci sono molti meccanismi aggiuntivi di controllo dell'espressione genica negli eucarioti poiché il genoma è molto più grande. I geni sono presenti nel nucleo dove viene sintetizzato l'mRNA. L'mRNA viene quindi esportato nel citoplasma dove avviene la traduzione.

Negli eucarioti, l'organizzazione è multicellulare e specializzata in tessuti e organi. Le cellule sono differenziate e le cellule di un tessuto generalmente producono una proteina specifica che coinvolge un particolare insieme di geni. Tutti gli altri geni vengono spenti in modo permanente e non vengono mai trascritti.

Le caratteristiche strutturali degli eucarioti che influenzano l'espressione genica sono la presenza di nucleosomi nella cromatina, l'eterocromatina e la presenza dei geni scissi nei cromosomi.

Rispetto ai geni procarioti, i geni eucariotici hanno molti più siti di legame regolatori e sono controllati da molte più proteine ​​regolatorie. Le sequenze regolatorie possono essere presenti a migliaia di nucleotidi distanti dal promotore, possono trovarsi a monte ea valle. Queste sequenze regolatorie agiscono a distanza. Il DNA interposto si sviluppa, in modo che la sequenza regolatoria e il promotore giungano a giacere l'uno vicino all'altro.

La maggior parte della regolazione del controllo genico avviene all'inizio del livello di trascrizione. L'inizio della traduzione influenza immensamente anche la regolazione genica.

Modifica della cromatina:

Il genoma degli eucarioti è avvolto da proteine ​​istoniche per formare nucleosomi. Questa condizione porta all'occultamento parziale dei geni e riduce l'espressione dei geni.

L'impaccamento del DNA con gli ottomeri dell'istone non è permanente. Qualsiasi porzione di DNA può essere rilasciata dall'ottomero ogni volta che le proteine ​​che legano il DNA devono agire su di esso. Queste proteine ​​o enzimi che legano il DNA riconoscono i loro siti di legame sul DNA solo quando viene rilasciato dall'ottomero dell'istone o quando sono presenti sul DNA linker. Il DNA viene scartato dai nucleosomi.

Questo srotolamento del DNA dai nucleosomi viene eseguito da enzimi modificatori del nucleosoma o dal complesso di rimodellamento del nucleosoma. Agiscono in vari modi. Possono rimodellare la struttura dell'ottomero o far scorrere l'ottomero lungo il DNA, scoprendo così i siti di legame del DNA per l'azione delle proteine ​​regolatrici. Così i geni vengono attivati.

Alcuni di questi modificatori del nucleosoma aggiungono gruppi acetilici (acetilazione) alle code degli istoni, quindi allentano l'involucro del DNA e nel processo espongono i siti di legame del DNA. Tutto ciò porta all'espressione dei geni. Allo stesso modo, la deacetilazione da parte delle deacetilasi provoca l'inattivazione del DNA.

I nucleosomi sono del tutto assenti nelle regioni attive nella trascrizione come i geni rRNA.

La forma densa della cromatina è chiamata eterocromatina negli eucarioti. Porta all'inibizione genica o al silenziamento genico. L'eterocromatina è una parte densamente impacchettata della cromatina che non consente l'espressione genica. La cromatina densamente confezionata non può essere facilmente trascritta. Alcuni enzimi rendono la cromatina più densa. Telomeri e contromeri sono sotto forma di eterocromatina.

Negli animali superiori circa il 50% del genoma è sotto forma di eterocromatina. Gli enzimi sono in grado di modificare la densità della cromatina modificando chimicamente le code degli istoni. Ciò influisce sulla trascrizione.

In questo modo, sia l'attivazione che la repressione della trascrizione vengono eseguite modificando la cromatina in eterocromatina ed eucromatina.

La metilazione di alcune sequenze di DNA impedisce la trascrizione dei geni nei mammiferi. È stato osservato che i geni fortemente metilati non vengono trascritti, quindi non espressi. Gli enzimi della DNA metilasi causano la metilazione di alcune sequenze di DNA, silenziando così i geni.

Controllo della trascrizione da parte degli ormoni:

Vari segnali intercellulari e intracellulari regolano l'espressione genica.

Gli ormoni esercitano un controllo considerevole sulla trascrizione. Gli ormoni sono sostanze extracellulari sintetizzate dalle ghiandole endocrine. Sono trasportati alle cellule bersaglio distanti. Vari ormoni come l'insulina, l'estrogeno, il progesterone, il testosterone ecc. agiscono spesso con “accendere” trascrizione del DNA.

L'ormone entrando in una cellula bersaglio forma un complesso con il recettore presente nel citoplasma. Questo complesso ormone-recettore entra nel nucleo e si lega a un particolare cromosoma per mezzo di proteine ​​specifiche. Questo avvia la trascrizione. Il complesso ormone-recettore può aumentare o sopprimere l'espressione dei geni.

È stato osservato nei polli che quando viene iniettato l'ormone estrogeno, l'ovidotto risponde sintetizzando l'mRNA, che è responsabile della sintesi dell'albume. L'ormone si lega direttamente al DNA e agisce come induttore.

Regolamento di elaborazione di mRNA:

I geni degli eucarioti hanno regioni non codificanti (introni) tra regioni codificanti (esoni). Tali geni sono chiamati geni divisi. L'intero gene viene trascritto per produrre mRNA che è chiamato mRNA precursore o trascritto primario (pre-mRNA). Prima che avvenga la traduzione, gli introni vengono giuntati per escissione e scartati. Questo è noto come elaborazione dell'mRNA e l'mRNA elaborato è chiamato mRNA maturo. Questo prende parte alla sintesi proteica. L'mRNA maturo è considerevolmente più piccolo dell'mRNA precursore.

Gli eucarioti superiori hanno vari meccanismi mediante i quali il pre-mRNA viene elaborato in modi alternativi o differenziali per produrre diversi mRNA che codificano proteine ​​diverse. Molteplici proteine ​​sono prodotte da un gene mediante elaborazione alternata dell'mRNA. Molte cellule sfruttano diversi percorsi di splicing per alterare l'espressione dei geni e sintetizzare diversi polipeptidi. Lo splicing alternativo dell'mRNA aumenta il numero di proteine ​​espresse da un singolo gene eucariotico.

L'elaborazione alternativa del pre-mRNA si ottiene saltando l'esone, trattenendo alcuni introni, ecc.

Questi percorsi di elaborazione alternativi sono altamente regolamentati.

Nella drosophilla l'mRNA viene processato in quattro modi diversi, quindi produce quattro diversi tipi di miosina proteica muscolare. Diversi tipi di miosina vengono prodotti nelle fasi larvale, pupa e tardiva dell'embrione.

Controllo della durata di mRNA:

Nei procarioti la durata della vita di una molecola di mRNA è molto breve, dura solo un minuto o meno. L'mRNA degenera immediatamente dopo la sintesi proteica.

Ma poiché l'mRNA negli eucarioti viene trasportato nel citoplasma attraverso i nucleopori, questo mRNA viene ripetutamente tradotto. Questa traduzione ripetuta dell'mRNA si ottiene aumentando la durata della vita dell'mRNA. In una cellula altamente differenziata, una singola molecola di mRNA avente una lunga durata è in grado di produrre grandi quantità di singola proteina. La durata della vita di un mRNA eucariotico varia da poche ore a diversi giorni.

Le cellule dell'ovidotto di pollo hanno una singola copia del gene dell'ovobumen ma producono una grande quantità di albume.

La ghiandola della seta del baco da seta produce un filo molto lungo fatto di fibroina proteica, che forma un bozzolo. La ghiandola della seta è una singola cellula poliploide. Produce un gran numero di molecole di mRNA, che hanno una lunga durata di diversi giorni.

Amplificazione genica:

Esiste un meccanismo in vari organismi per cui il numero di geni aumenta di molte volte senza divisione della mitosi. Questo è chiamato amplificazione genica.

Durante l'amplificazione il DNA subisce ripetutamente la replicazione senza separazione mitotica in molecole di DNA figlia o cromatidi. Ciò consente alla cellula di produrre grandi quantità di proteine ​​in breve tempo.

Regolamento post traduzione:

Nei procarioti, una singola molecola di mRNA policistronico codifica per molte proteine ​​diverse. Ma negli eucarioti con mRNA mono-cistronico, la sintesi di diverse proteine ​​viene ottenuta in modo diverso. Un singolo mRNA produce un grande polipeptide chiamato poliproteina. Questa poliproteina viene quindi scissa in modi alternativi per produrre proteine ​​diverse. Ogni proteina è considerata come il prodotto di un singolo gene. In questo sistema, ci sono molti siti di scissione sul polyprotien.

Silenziamento genico post-trascrizione:

Negli eucarioti esistono molti piccoli RNA che svolgono il loro ruolo nel silenziamento dei geni. Questi piccoli RNA agiscono sull'mRNA con conseguente interruzione della traduzione. Questi piccoli RNA sono micro RNA (miRNA), piccoli RNA interferenti (siRNA) e molti altri.


Esistono geni eucarioti senza introni?

La nostra professoressa ci ha detto che esistono geni eucariotici senza introni, ma non ha detto quali geni sarebbero.

Questo è più tangenziale dei geni eucarioti che si sono evoluti per milioni di anni senza introni, ma non ho risorse accademiche per questa situazione.

Tuttavia, è stato scoperto che una classe di animali microscopici chiamati rotiferi bdelloid ha alcune proprietà sorprendenti. Una proprietà interessante dei bdelloid è che possono sopravvivere a un completo disseccamento - assenza di acqua - in qualsiasi fase del loro ciclo di vita. La maggior parte degli organismi può sopravvivere all'essiccamento solo in determinati cicli di vita (come i semi delle piante). Questo sembra essere il risultato di capacità di riparazione del DNA davvero sorprendenti.

Come si lega questo ai geni eucariotici senza introni? Bene, quando i rotiferi bdelloid si seccano, le loro membrane cellulari si aprono, proprio come con molti altri organismi. Quando l'acqua arriva e spuntano, sembra che il DNA frammentato di altri organismi inariditi a volte venga lavato nei bdelloid, e gli incredibili meccanismi di riparazione del DNA integrano semplicemente questo DNA nel genoma bdelloid.

Il risultato è che i bdelloid moderni hanno versioni relativamente moderne di geni provenienti da organismi drasticamente imparentati, tra cui piante, funghi e persino batteri. Alcuni geni sono rotti, altri sembrano essere funzionali ma non utilizzati e altri producono prodotti proteici attivi nei bdelloid viventi. Sorprendentemente, c'è un caso di un gene che è praticamente identico a un gene di e. coli. tranne che ha in mano un introne inserito in esso dai bdelloids. Nella trascrizione, i bdelloid rimuovono l'introne e produce un enzima funzionale. Presumibilmente, a un certo punto, questo era un gene che funzionava senza introni.


MATERIALI E METODI

Ceppi e plasmidi

Due colonie indipendenti del ceppo 10I (STUOIAunura3?0/ura3?0 leu2?0/leu2?0 lys2?0/lys2?0 ADE2/ade2?::hisG HIS3/his3?200) sono stati utilizzati in parallelo per le delezioni di introni, questi ceppi sono stati creati accoppiando i ceppi LLY34 (STUOIAunura3?0 leu2?0 lys2?0 ade2?::hisG) e LLY35 (STUOIAα ura3?0 leu2?0 lys2?0 suoi3?200). I ceppi LLY34 e LLY35 sono stati ottenuti accoppiando i ceppi BY4700 (STUOIAunura3?0) e BY4705 (STUOIAα ura3?0 leu2?0 lys2?0 ade2?::hisG his3?200 trp1?63 incontrato15?0 Brachmann et al., 1998). Le cellule prive di MTR2 gene (JPY500) sono stati creati sostituendo la sequenza codificante e le UTR 5′ e 3′ con URA3 gene utilizzando la sostituzione genica standard basata su PCR (Sikorski e Hieter, 1989) nel ceppo 10I2. I frammenti di PCR sono stati generati utilizzando i primer D-MTR2_for, 5′-GCACGCTTGGCGTCAATATCCTAAAACGGAAAACTAATCAGTTAGATGTGAGATTGTACTGAGAGTGCAC-3′ e D-MTR2_rev, 5′-GTACCCGTGCAGCCGTTTCCGTGCCTCGGTTCCTCCGAGATATCCTTAGGCTGTGCGGTATTTCACACCG-3′ (le basi sottolineate sono complementari ai plasmidi pRS Sikorski e Hieter, 1989). ceppi mancano YRA1 e il TAD3 i geni sono stati ottenuti dai ceppi knockout del lievito di Open Biosystems (Open Biosystems, Huntsville, AL, record n. 24217: STUOIAunura3?0/ura3?0 leu2?0/leu2?0 lys2?0/LYS2 suo3?1/his3?1 met15?0/MET15 anno1?::KMX4/YRA1 e registrare n. 25225: STUOIAunura3?0/ura3?0 leu2?0/leu2?0 lys2?0/LYS2 suo3?1/his3?1 met15?0/MET15 tad3?::KMX4/TAD3, rispettivamente). Il plasmide pISCE è stato generato inserendo un frammento EcoRI da 3,85 kb di pPEX7 (Fairhead e Dujon, 1993) contenente l'endonucleasi I-SceI sotto il controllo dell'inducibile GAL1-CYC1 promotore nel sito EcoRI di pRS424 (Christianson et al., 1992). Il plasmide di espressione pRS425-SCE è stato costruito inserendo il frammento SacI-ApaI da 3,94 kb di pISCE nel frammento SacI-ApaI da 6753 coppie di basi di pRS425 (Christianson et al., 1992). Il plasmide pURA3-SCE che contiene il sito di riconoscimento di I-SceI davanti al URA3 marcatore è stato costruito inserendo due oligonucleotidi ricotti (Nde.SCE per: TACCGTAGGGATAACAGGGTAATCGG e Nde.SCE rev: TACCGATTACCCTGTTATCCCTACGG, dove le basi sottolineate sono il sito I-SceI) nel sito NdeI di pRS306 (Sikorski e Hieter, 1989). Per amplificare il lievito ATTO 1 promotore da DNA genomico wild-type, abbiamo utilizzato i seguenti primer per la PCR: XhoI-ACT1p-F 5′-CTCCTCGAGCTCACCCTAACATATTTTCCAATTA-3′ (le basi sottolineate sono complementari alla posizione da −450 a −435 rispetto alla ATTO 1 sito di inizio traslazionale e l'estensione 5′ contiene un sito XhoI) e HindIII-ACT1p-rev 5′-CCCAAGCTTTGTTAATTCAGTAAATTTTCGATCT-3′ (le basi sottolineate sono complementari alla posizione da −25 a −1 rispetto alla ATTO 1 sito di inizio traslazionale e l'estensione 5′ contiene un sito HindIII). Il prodotto della PCR è stato digerito con XhoI e HindIII e clonato in pRS316 (Sikorski e Hieter, 1989) per generare pACT1pr. Il mtr2?1i, mtr2?2i, mtr2?3i, mtr2?4i, mtr2?5i, e mtr2?6i i geni sono stati amplificati mediante PCR dal rispettivo ceppo di lievito diploide eterozigote con primer creati contro le regioni da -262 a -237 e da +1681 a +1706 rispetto al MTR2 codone di inizio definito da Saccharomyces banca dati del genoma (SGD). I prodotti della PCR sono stati digeriti con gli enzimi di restrizione appropriati e clonati in pACT1pr. Il gene del lievito YRA1 con o senza introne (Δi) è stato amplificato mediante PCR da wild-type o yra1?io DNA, rispettivamente, con primer creati contro regioni 0 (senza promotore) o 430 paia di basi (con proprio promotore) a monte del codone di inizio e 153 paia di basi a valle del codone di stop. I prodotti della PCR sono stati digeriti con gli opportuni enzimi di restrizione e clonati in pACT1pr o pRS316 (Sikorski e Hieter, 1989). Il pACT1pr-TAD3Δ2i è stato costruito inserendo il TAD3 cDNA nel plasmide pACT1pr. Le cellule di lievito sono state trasformate mediante una modifica (Gietz e Woods, 2002) del metodo dell'acetato di litio (Ito et al., 1983) e sono stati coltivati ​​in terreni di lievito standard (Zakian e Scott, 1982 Rose et al., 1990). Tutti i plasmidi sono stati propagati nei batteri utilizzando lo standard Escherichia coli ceppi e condizioni di crescita (Sambrook et al., 1989).

Strategia di spostamento diretto degli introni

Per rimuovere un introne, abbiamo utilizzato la strategia di spostamento diretto dell'introne descritta nella Figura S1A. Un frammento contenente il sito di riconoscimento dell'endonucleasi I-SceI davanti al URA3 gene marcatore è stato amplificato dal plasmide pURA3-SCE. Il primer diretto usato per amplificare URA3 includeva 80 nucleotidi complementari alla sequenza dell'esone 2 dei geni mirati, mentre il primer inverso includeva 45 nucleotidi complementari alla sequenza degli introni mirati. I prodotti della PCR generati sono stati utilizzati in un secondo ciclo di amplificazione della PCR come stampo. Il primer inverso era lo stesso utilizzato nel primo round, mentre il primer in avanti includeva una sequenza che rappresentava la perfetta giunzione tra l'esone 1 (45 nt) e l'esone 2 (55 nt). Questo prodotto di PCR risultante è stato trasformato nei ceppi di lievito diploide 10I1 e 10I2 che ospitano il plasmide pRS425-SCE. Dopo aver verificato l'inserimento del frammento mediante PCR, la produzione dell'enzima I-SceI è stata indotta per 8 h a 30°C facendo crescere le cellule in presenza di galattosio (concentrazione finale, 2%) per favorire il pop-out del URA3 gene (Plessis et al., 1992 Lukacsovich et al., 1994 Cohen-Tannoudji et al., 1998). Perdita del URA3 marcatore è stato vagliato coltivando cellule su terreni contenenti acido 5-fluoroorotico (5-FOA Boeke et al., 1987). Le cellule contenenti le sostituzioni corrette sono state sporulate e sezionate e i ceppi aploidi contenenti l'allele mutato sono stati accoppiati insieme per ottenere ceppi di lievito diploide omozigote. Ogni fase della strategia di spostamento diretto dell'introne è stata verificata mediante amplificazione PCR utilizzando primer a monte ea valle della giunzione degli esoni 1 e 2. L'elenco dei primer utilizzati può essere fornito su richiesta.

Saggi di crescita

I ceppi di lievito sono stati fatti crescere fino a 4 × 10 6 cellule/ml in terreno di crescita ricco (YPD). Per i test sui farmaci, 50 μl di sospensione di cellule di lievito sono stati aggiunti a 50 μl di ciascun farmaco diluito in YPD (vedere la tabella S1 per la concentrazione finale le concentrazioni di farmaco sono state regolate per ridurre la crescita delle cellule wild-type del 50%). Per i saggi sulle fonti di carbonio, le cellule di lievito sono state lavate due volte e risospese in un mezzo ricco senza glucosio (YEP). I saggi sono stati effettuati mescolando un volume uguale di cellule di lievito lavate e YEP. La fonte di carbonio è stata aggiunta separatamente e regolata ad una concentrazione finale del 2% ad eccezione del glicerolo che era del 3%. I campioni sono stati preparati in triplicato e il test è stato eseguito su una micropiastra Costar da 96 pozzetti in polistirene non trattato (Fisher Scientific Company, Ottawa, ON, Canada) e la crescita è stata monitorata utilizzando il lettore di spettrofotometri per micropiastre PowerWave (BioTek Instruments, Winooski, VT Toussaint et al., 2006). Metil metansolfonato (MMS), perossido di idrogeno (H2oh2), benomil, ketoconazolo, camptotecina, bianco calcofluor, cicloesimide e caffeina sono stati ottenuti da Sigma-Aldrich Canada (Oakville, ON, Canada). L'igromicina B è stata ottenuta da Roche Diagnostics (Laval, QC, Canada). La staurosporina e la ciclosporina A sono state ottenute da Alexis (Alexis Biochemicals, San Diego, CA). La latrunculina A è stata ottenuta da Calbiochem (VWR CANLAB, Mississauga, ON, Canada).

Analisi delle curve di crescita

Il tasso di crescita massimo (μm) di ciascuna curva di crescita è stata calcolata come descritto in precedenza (Toussaint et al., 2006). Per ogni micropiastra da 96 pozzetti, le cellule mutanti μm è stata divisa per quella calcolata per la coltivazione di tipo selvatico nella stessa piastra.

Test di forma fisica

I saggi di crescita competitiva sono stati eseguiti aggiungendo una quantità uguale (6,5 × 10 5 cellule/ml) di wild-type (ade2sfondo) e Δi (ADE2 sfondo) ceppi in 25 ml di YPD contenente 100 μg/ml di adenina per evitare l'accumulo della pigmentazione rossa di ade2 mutanti. Le colture miste sono state coltivate a 30°C e diluite ogni giorno (a 6,5 ​​× 10 5 cellule/ml) fino a raggiungere 50 generazioni (±2). Il numero di generazioni è stato calcolato utilizzando questa equazione: [G = ln (CF/Cio)/ln (2)], dove G rappresenta il numero di generazioni e CF e Cio sono rispettivamente la concentrazione finale e iniziale delle cellule delle colture miste. All'inizio dell'esperimento (generazione 0) e dopo 50 divisioni, 300 cellule delle colture miste sono state piastrate su piastre SC contenenti una bassa concentrazione di adenina (20 μg/ml) per consentire la pigmentazione rossa di ade2cellule e coltivate a 30°C. Le cellule bianche (Δi) e rosse (tipo selvatico) sono state contate per calcolare la percentuale di ciascun ceppo all'inizio e alla fine dell'esperimento.

Macchia settentrionale

L'RNA totale da cellule in crescita esponenziale è stato isolato e macchiato come descritto in precedenza (Abou Elela et al., 1996 Abu Elela e Ares, 1998). I livelli di ciascun mRNA sono stati quantificati utilizzando una sonda di priming casuale complementare all'ultimo esone del gene corrispondente. La quantificazione per tutti i segnali è stata ottenuta mediante imaging di fosfori di memorizzazione con il software Storm e ImageQuant (GE Healthcare Bio-Sciences, Baie d'Urfé, QC, Canada). I livelli di mRNA dei geni senza introni sono stati normalizzati a HSC82 o RPL8A utilizzati come controllo interno. Caricamento del SAC6 L'mRNA è stato normalizzato utilizzando l'rRNA 25S come riferimento.


Materiali e metodi

Origine dei dati

Abbiamo ottenuto dati pubblicamente disponibili sul genoma e sulla sequenza di cDNA a lunghezza intera per D. melanogaster, A. thaliana, umano e topo (tabella 1). I confini tra UTR e CDS in sequenze di cDNA a lunghezza intera sono stati determinati utilizzando annotazioni da GenBank (D. melanogaster e A. thaliana) e il Consorzio del genoma dei mammiferi (umano e topo).

Sorgenti e versioni per dati di sequenza di cDNA e genoma a lunghezza intera

Specie Sequenza del genoma cDNA a tutta lunghezza Riferimento
Arabidopsis thalianaThe Institute for Genome Research (versione 13 giugno 2001) Oryza Enciclopedia di biologia molecolare basata sulla conoscenza (24 ottobre 2003) ( Castelli et al. 2004)
Drosophila melanogasterBerkeley Drosophila Genome Project (versione 3) Berkeley Drosophila Genome Project (10 luglio 2003) (Stapleton et al. 2002)
Umano GenBank (build 34.3) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Topo GenBank (build 32,1) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Specie Sequenza del genoma cDNA a tutta lunghezza Riferimento
Arabidopsis thalianaThe Institute for Genome Research (versione 13 giugno 2001) Oryza Enciclopedia di biologia molecolare basata sulla conoscenza (24 ottobre 2003) ( Castelli et al. 2004)
Drosophila melanogasterBerkeley Drosophila Genome Project (versione 3) Berkeley Drosophila Genome Project (10 luglio 2003) (Stapleton et al. 2002)
Umano GenBank (build 34.3) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Topo GenBank (build 32,1) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)

Sorgenti e versioni per dati di sequenza di cDNA e genoma a lunghezza intera

Specie Sequenza del genoma cDNA a tutta lunghezza Riferimento
Arabidopsis thalianaThe Institute for Genome Research (versione 13 giugno 2001) Oryza Enciclopedia di biologia molecolare basata sulla conoscenza (24 ottobre 2003) ( Castelli et al. 2004)
Drosophila melanogasterBerkeley Drosophila Genome Project (versione 3) Berkeley Drosophila Genome Project (10 luglio 2003) (Stapleton et al. 2002)
Umano GenBank (build 34.3) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Topo GenBank (build 32,1) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Specie Sequenza del genoma cDNA a tutta lunghezza Riferimento
Arabidopsis thalianaThe Institute for Genome Research (versione 13 giugno 2001) Oryza Enciclopedia di biologia molecolare basata sulla conoscenza (24 ottobre 2003) ( Castelli et al. 2004)
Drosophila melanogasterBerkeley Drosophila Genome Project (versione 3) Berkeley Drosophila Genome Project (10 luglio 2003) (Stapleton et al. 2002)
Umano GenBank (build 34.3) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)
Topo GenBank (build 32,1) Consorzio Genoma dei Mammiferi (28 gennaio 2004) ( Strausberg et al. 2002)

Posizioni degli introni

Le posizioni degli introni sono state determinate attraverso il riconoscimento di lacune nell'allineamento dei trascritti di cDNA a lunghezza intera con le sequenze genomiche. In breve, per un singolo cDNA a lunghezza intera allineato contro un tratto contiguo di sequenza genomica, gli esoni sono stati determinati come blocchi prossimali di allineamento di sequenze omologhe tra cDNA a lunghezza intera e sequenza genomica, mentre gli introni sono stati determinati come spazi tra esoni costituiti esclusivamente da sequenza.

Per prima cosa abbiamo pulito le librerie di cDNA a lunghezza intera rimuovendo le trascrizioni con annotazioni incoerenti e CDS incompleti. Abbiamo quindi allineato la libreria pulita dei trascritti di cDNA a lunghezza intera alle sequenze del genoma con BLAT (Kent 2002). Oltre ad essere molto veloce, l'algoritmo di ricerca utilizzato da BLAT ha almeno due vantaggi per l'allineamento dei trascritti potenzialmente splicing alle sequenze genomiche. Innanzitutto, BLAT inizia cercando corrispondenze di alta qualità di brevi sequenze discrete (K-mers, ciascuna 8-16 nt) e tenta di "cucire insieme" K-mers prossimali di alta qualità estendendo la corrispondenza attraverso sequenze intermedie che anche fornire corrispondenze di alta qualità. La scala in cui ciò si verifica è quella della tipica dimensione dell'esone. In secondo luogo, una volta che i K-mer sono cuciti in blocchi di allineamento di alta qualità, gli spazi tra i blocchi corrispondenti vengono regolati in modo che le estremità degli spazi forniscano la migliore corrispondenza alle sequenze consenso tipiche delle estremità degli introni ( Kent 2002).

L'allineamento BLAT per ogni trascrizione è stato perfezionato in due passaggi. Innanzitutto, è stato scelto il miglior allineamento, definito come quell'allineamento avente l'identità di sequenza più alta maggiore del 95% se nessun allineamento aveva un'identità di sequenza maggiore del 95%, la trascrizione è stata scartata. Se c'erano più allineamenti migliori con identità di sequenza uguale, è stato scelto l'allineamento più lungo. In secondo luogo, sono stati uniti blocchi di esone putativi separati da meno di 5 bp. In alcune condizioni di sequenza e dimensione del gap, BLAT non unisce i blocchi prossimali (Kent 2002). Abbiamo ragionato sul fatto che le lacune con meno di 5 bp rappresentano indel all'interno di sequenze di trascrizione a lunghezza intera piuttosto che introni effettivi. Queste piccole lacune si sono verificate nello 0,02% di A. thaliana allineamenti a figura intera, 15% di D. melanogaster allineamenti, il 19% degli allineamenti umani e il 25% degli allineamenti del mouse. Per allineamento a lunghezza intera contenente gap, la lunghezza totale media del gap era di 7,7 bp in A. thaliana, 2,8 bp pollici D. melanogaster, 6,2 bp nell'uomo e 6,7 bp nel topo. Abbiamo unito queste lacune mentre ci muovevamo attraverso ogni allineamento in una direzione 5'-3' lungo il filamento genomico di senso positivo. We thus introduced the possibility of a slight bias to intron positions that increases in absolute magnitude from 0 bp at the intron in the 5′-most genomic position within the alignment to a maximum of the total gap length at the intron in the 3′-most genomic position within the alignment. For genes encoded on the positive-sense genomic strand, this bias increased in the 5′–3′ direction within the full-length transcript, whereas for genes encoded on the negative-sense genomic strand, this bias increased in the 3′-to-5′ direction within the transcript. As genes have essentially equal proportions of positive- and negative-sense orientations in these genomes, the data set-wide degree of bias was negligible. We recorded intron positions according to their location from the 5′ end of each full-length transcript.

Following the refinement of the BLAT alignment, we created our set of “qualifying transcripts.” A qualifying transcript contained at least one intron within its 5′ UTR, CDS, or 3′ UTR, as indicated by the alignment. Additionally, to avoid potential inconsistencies introduced by our use of automated alignments, we required that all introns in a qualifying transcript were between 20 bp and 100 kbp (100,000 bp) in length. We chose 20 bp as our minimum intron size because we were concerned about the potential inflation of intron numbers due to spurious gaps larger than our merge limit of 5 bp, and because very few introns are known to be less than 20 bp in length. For example, minimum CDS intron size was 13 bp in 2903 genes from 10 eukaryotes ( Deutsch and Long 1999) and minimum intron size in ESTs was 27 bp in a diverse collection of fungi ( Kupfer et al. 2004). A number of introns as large as 100 kbp and larger are known in, for example, humans ( Nobile et al. 1997 Bärlund et al. 2002) but we did not wish to include such introns in our data set without manual confirmation of each such alignment. Such extremely large introns were extremely rare in our data set. For all species, larger data sets constructed using less stringent qualifying rules resulted in equivalent estimates and distributions, though the occurrence of extremely large introns (>100 kbp) for D. melanogaster, human, and mouse somewhat increased estimates sensitive to extreme outliers (data not shown).

Statistical Analysis of Intron Distribution

We analyzed the general distribution of introns within each region by examining the distribution of exon sizes, which are directly dependent upon intron locations. For example, the expected mean exon size for a region containing nio introns is (length of region/(nio + 1)) regardless of the pattern of intron distribution, so we instead calculate the effective number of exons ne, which is sensitive to the variance in exon size ( Lynch and Kewalramani 2003). When introns are uniformly distributed, resulting in all exons having equal length, then ne = nio + 1. When introns are closely clumped so that one exon is much longer than the others, then ne approaches 1. To calculate ne, for each exon within a region, we determined its size eio relative to the total length of the region, so that the eio within each region sum to 1. We then calculated ne for each species, region, and number of introns using ne = 1/∑i=1 n eio 2 , which is equivalent to the classical formula used in population genetics to calculate the effective number of alleles for a locus ( Kimura and Crow 1964).

Falling between the two extremes of ne = 1, for unusually high variation in exon length, and ne = nio + 1, for no variation in exon length, are expected values of ne for a random distribution of introns within a region, which serve as a null model for comparison. Introns positioned at random create a distribution of exon sizes that follows the “broken-stick” distribution for random partitions of a finite distance ( MacArthur 1957 Goss and Lewontin 1996 Lynch and Kewalramani 2003). For each set of species' genes containing nio = 1–5 introns in a region, we calculated mean ne ± standard error. We then calculated the broken-stick expectation of ne per nio random intron locations via simulation. To create this null expectation, we randomly chose a region length in bp from the set of all observed regions having nio introns for each species, with replacement. Within this randomly chosen observed region length, we then randomly chose locations for nio introns and calculated the relative length eio of each resulting exon. abbiamo calcolato ne for this simulated region and repeated this for 10 5 iterations for each combination of species, region, and number of introns nio. We call this random distribution of ne values the “unrestricted random distribution.” Other than an absolute minimum exon size limit of 1 bp, we did not place a lower limit on exon size in these simulations, so this approach assumes an absence of exon-size constraints. However, such extremely short exons are quite rare ( Deutsch and Long 1999) and introduce the possibility of numerous splicing difficulties ( Dominiski and Kole 1991, 1992 Sterner and Berget 1993 Carlo et al. 1996). We thus also simulated “minimum-exon-size random distributions” for each combination of species, region, and number of introns. In these simulations, the random draw of intron locations was repeated until the size of the smallest resulting exon was ≥20 bp this is somewhat smaller than the smallest exon size that can apparently be constitutively spliced reliably without additional splicing enhancers (∼50 bp Dominiski and Kole 1991, 1992). The minimum-exon-size random distribution has a larger mean ne than the unrestricted random distribution, and the difference between the mean ne of the two distribution increases as the length of the simulated region decreases (see also Goss and Lewontin 1996). As there are species-specific relationships between mean total exon length of a region and the number of introns found therein ( Lynch and Kewalramani 2003), our minimum-exon-size distributions are not independent of species identities. There is negligible difference among species in the two random distributions within CDSs (data not shown). However, the shorter lengths of 5′ UTRs accentuate the among-species differences ( fig. 3), such that we present separate minimum-exon-size random distributions for human and mouse as a group, and for A. thaliana e D. melanogaster as a group.

Here, we will call observed intron distributions overdispersed or underdispersed in comparison to one of these random distributions if the mean ne value is greater than or less than, respectively, the simulated values of ne for the appropriate random distribution. Overdispersed introns are more uniformly distributed in the region in comparison to a random distribution, whereas underdispersed introns are more clumped.


Chromosome and Eukaryotic Chromosome: Difference

1. Structural organization of bacterial chromosome is simple and is represented mainly by double-stranded DNA molecule. Although there are specific proteins associated with bacterial chromosome (not the histories) that help stabilize its supercoiled domains. Compared to eukaryotic chromosome, one can consider bacterial chromosome to be naked DNA.

2. Bacterial chromosome is covalently closed circular structure consisting of only a single molecule of DNA (with few exceptions such as Borellia burgdorfii and Streptomyces the chromosomes of which are linear).

3. Only one bacterial chromosome occurs per bacterial cell (with few exceptions such as Rhodobacter sphaeroides, a gram-negative phototroph that possesses 2 chromosomes per cell).

4. Bacterial chromosome contains only a single copy of each gene and is therefore genetically haploid.

5. Bacterial chromosomes are shorter and contain lesser number of genes.

6. Bacterial chromosome lies free in the cell cytoplasm without any membrane to separate the chromosome from the cytoplasm., Since the ribosomes also occur free in cell cytoplasm, the process of transcription and translation are not spatially separated.

7. Except few, the bacterial DNAs do not contain introns, the noncoding sequences. As a result, the protein coding genes are not interrupted by introns and synthesize a single mRNA often containing more than one coding region. Each coding region independently synthesizes one or more proteins depending upon the number of operons (Fig. 5.37).

Differenza # Eukaryotic Chromosome:

1. Structural organization of eukaryotic chromosome is complex as it contains more than just DNA. In addition to DNA large amount of histone proteins wound around DNA molecule in a very regular fashion to form structures called nucleosome. The nucleosomes aggregate to form a fibres material called chromatin, which itself further compact by folding and looping to eventually form very dense structure called chromosome.

2. Each eukaryotic chromosome is linear and consists of several pieces of DNA.

3. Eukaryotic chromosomes are more than one per cell, and this number varies with the organism. For example, Saccharomyces cerevisiae, a single-called Baker’s yeast, contains 16 chromosomes arranged in eight pairs, while human cells contain 46 chromosomes arranged in 23 pairs.

4. Eukaryotic chromosome typically contains 2 copies of each gene and is therefore genetically diploid. The diploid eukaryotic genome is halved to haploid via the process called meiosis.

5. Eukaryotic chromosomes are larger and contain greater number of genes.

6. Eukaryotic chromosome occurs in the cell nucleus, which is surrounded by nuclear membrane that separates chromosome from the cytoplasm while the ribosomes are in the cytoplasm, the processes of transaction and translation are spatially separated.

7. Eukaryotic chromosome contains both introns (noncoding sequence) and exons (coding sequence). As a result, the protein coding genes are interrupted by introns. Both introns and exons are transcribed into the primary RNA transcript from which the nature (functional) mRNA is formed by excision of introns and transported to the cytoplasm for translation (protein synthesis) (Fig. 5.38).


Contenuti

Introns were first discovered in protein-coding genes of adenovirus, [8] [9] and were subsequently identified in genes encoding transfer RNA and ribosomal RNA genes. Introns are now known to occur within a wide variety of genes throughout organisms and viruses within all of the biological kingdoms.

The fact that genes were split or interrupted by introns was discovered independently in 1977 by Phillip Allen Sharp and Richard J. Roberts, for which they shared the Nobel Prize in Physiology or Medicine in 1993. [10] The term introne was introduced by American biochemist Walter Gilbert: [5]

"The notion of the cistron [i.e., gene] . must be replaced by that of a transcription unit containing regions which will be lost from the mature messenger – which I suggest we call introns (for intragenic regions) – alternating with regions which will be expressed – exons." (Gilbert 1978)

Il termine introne si riferisce anche a intracistron, i.e., an additional piece of DNA that arises within a cistron. [11]

Although introns are sometimes called intervening sequences, [12] the term "intervening sequence" can refer to any of several families of internal nucleic acid sequences that are not present in the final gene product, including inteins, untranslated regions (UTR), and nucleotides removed by RNA editing, in addition to introns.

The frequency of introns within different genomes is observed to vary widely across the spectrum of biological organisms. For example, introns are extremely common within the nuclear genome of jawed vertebrates (e.g. humans and mice), where protein-coding genes almost always contain multiple introns, while introns are rare within the nuclear genes of some eukaryotic microorganisms, [13] for example baker's/brewer's yeast (Saccharomyces cerevisiae). In contrast, the mitochondrial genomes of vertebrates are entirely devoid of introns, while those of eukaryotic microorganisms may contain many introns. [14]

A particularly extreme case is the Drosophila dhc7 gene containing a ≥3.6 megabase (Mb) intron, which takes roughly three days to transcribe. [15] [16] On the other extreme, a recent study suggests that the shortest known eukaryotic intron length is 30 base pairs (bp) belonging to the human MST1L gene. [17]

Splicing of all intron-containing RNA molecules is superficially similar, as described above. However, different types of introns were identified through the examination of intron structure by DNA sequence analysis, together with genetic and biochemical analysis of RNA splicing reactions.

At least four distinct classes of introns have been identified: [1]

    that are removed by spliceosomes (spliceosomal introns)
  • Introns in nuclear and archaeal transfer RNA genes that are removed by proteins (tRNA introns)
  • Self-splicing group I introns that are removed by RNA catalysis
  • Self-splicing group II introns that are removed by RNA catalysis

Group III introns are proposed to be a fifth family, but little is known about the biochemical apparatus that mediates their splicing. They appear to be related to group II introns, and possibly to spliceosomal introns. [18]

Spliceosomal introns Edit

Nuclear pre-mRNA introns (spliceosomal introns) are characterized by specific intron sequences located at the boundaries between introns and exons. [19] These sequences are recognized by spliceosomal RNA molecules when the splicing reactions are initiated. [20] In addition, they contain a branch point, a particular nucleotide sequence near the 3' end of the intron that becomes covalently linked to the 5' end of the intron during the splicing process, generating a branched (lariat) intron. Apart from these three short conserved elements, nuclear pre-mRNA intron sequences are highly variable. Nuclear pre-mRNA introns are often much longer than their surrounding exons.

TRNA introns Edit

Transfer RNA introns that depend upon proteins for removal occur at a specific location within the anticodon loop of unspliced tRNA precursors, and are removed by a tRNA splicing endonuclease. The exons are then linked together by a second protein, the tRNA splicing ligase. [21] Note that self-splicing introns are also sometimes found within tRNA genes. [22]

Group I and group II introns Edit

Group I and group II introns are found in genes encoding proteins (messenger RNA), transfer RNA and ribosomal RNA in a very wide range of living organisms., [23] [24] Following transcription into RNA, group I and group II introns also make extensive internal interactions that allow them to fold into a specific, complex three-dimensional architecture. These complex architectures allow some group I and group II introns to be self-splicing, that is, the intron-containing RNA molecule can rearrange its own covalent structure so as to precisely remove the intron and link the exons together in the correct order. In some cases, particular intron-binding proteins are involved in splicing, acting in such a way that they assist the intron in folding into the three-dimensional structure that is necessary for self-splicing activity. Group I and group II introns are distinguished by different sets of internal conserved sequences and folded structures, and by the fact that splicing of RNA molecules containing group II introns generates branched introns (like those of spliceosomal RNAs), while group I introns use a non-encoded guanosine nucleotide (typically GTP) to initiate splicing, adding it on to the 5'-end of the excised intron.

While introns do not encode protein products, they are integral to gene expression regulation. Some introns themselves encode functional RNAs through further processing after splicing to generate noncoding RNA molecules. [25] Alternative splicing is widely used to generate multiple proteins from a single gene. Furthermore, some introns play essential roles in a wide range of gene expression regulatory functions such as nonsense-mediated decay [26] and mRNA export. [27]

The biological origins of introns are obscure. After the initial discovery of introns in protein-coding genes of the eukaryotic nucleus, there was significant debate as to whether introns in modern-day organisms were inherited from a common ancient ancestor (termed the introns-early hypothesis), or whether they appeared in genes rather recently in the evolutionary process (termed the introns-late hypothesis). Another theory is that the spliceosome and the intron-exon structure of genes is a relic of the RNA world (the introns-first hypothesis). [28] There is still considerable debate about the extent to which of these hypotheses is most correct. The popular consensus at the moment is that introns arose within the eukaryote lineage as selfish elements. [29]

Early studies of genomic DNA sequences from a wide range of organisms show that the intron-exon structure of homologous genes in different organisms can vary widely. [30] More recent studies of entire eukaryotic genomes have now shown that the lengths and density (introns/gene) of introns varies considerably between related species. For example, while the human genome contains an average of 8.4 introns/gene (139,418 in the genome), the unicellular fungus Encephalitozoon cuniculi contains only 0.0075 introns/gene (15 introns in the genome). [31] Since eukaryotes arose from a common ancestor (common descent), there must have been extensive gain or loss of introns during evolutionary time. [32] [33] This process is thought to be subject to selection, with a tendency towards intron gain in larger species due to their smaller population sizes, and the converse in smaller (particularly unicellular) species. [34] Biological factors also influence which genes in a genome lose or accumulate introns. [35] [36] [37]

Alternative splicing of exons within a gene after intron excision acts to introduce greater variability of protein sequences translated from a single gene, allowing multiple related proteins to be generated from a single gene and a single precursor mRNA transcript. The control of alternative RNA splicing is performed by a complex network of signaling molecules that respond to a wide range of intracellular and extracellular signals.

Introns contain several short sequences that are important for efficient splicing, such as acceptor and donor sites at either end of the intron as well as a branch point site, which are required for proper splicing by the spliceosome. Some introns are known to enhance the expression of the gene that they are contained in by a process known as intron-mediated enhancement (IME).

Actively transcribed regions of DNA frequently form R-loops that are vulnerable to DNA damage. In highly expressed yeast genes, introns inhibit R-loop formation and the occurrence of DNA damage. [38] Genome-wide analysis in both yeast and humans revealed that intron-containing genes have decreased R-loop levels and decreased DNA damage compared to intronless genes of similar expression. [38] Insertion of an intron within an R-loop prone gene can also suppress R-loop formation and recombination. Bonnet et al. (2017) [38] speculated that the function of introns in maintaining genetic stability may explain their evolutionary maintenance at certain locations, particularly in highly expressed genes.

Starvation adaptation Edit

The physical presence of introns promotes cellular resistance to starvation via intron enhanced repression of ribosomal protein genes of nutrient-sensing pathways. [39]

Introns may be lost or gained over evolutionary time, as shown by many comparative studies of orthologous genes. Subsequent analyses have identified thousands of examples of intron loss and gain events, and it has been proposed that the emergence of eukaryotes, or the initial stages of eukaryotic evolution, involved an intron invasion. [40] Two definitive mechanisms of intron loss, reverse transcriptase-mediated intron loss (RTMIL) and genomic deletions, have been identified, and are known to occur. [41] The definitive mechanisms of intron gain, however, remain elusive and controversial. At least seven mechanisms of intron gain have been reported thus far: intron transposition, transposon insertion, tandem genomic duplication, intron transfer, intron gain during double-strand break repair (DSBR), insertion of a group II intron, and intronization. In theory it should be easiest to deduce the origin of recently gained introns due to the lack of host-induced mutations, yet even introns gained recently did not arise from any of the aforementioned mechanisms. These findings thus raise the question of whether or not the proposed mechanisms of intron gain fail to describe the mechanistic origin of many novel introns because they are not accurate mechanisms of intron gain, or if there are other, yet to be discovered, processes generating novel introns. [42]

In intron transposition, the most commonly purported intron gain mechanism, a spliced intron is thought to reverse splice into either its own mRNA or another mRNA at a previously intron-less position. This intron-containing mRNA is then reverse transcribed and the resulting intron-containing cDNA may then cause intron gain via complete or partial recombination with its original genomic locus. Transposon insertions can also result in intron creation. Such an insertion could intronize the transposon without disrupting the coding sequence when a transposon inserts into the sequence AGGT, resulting in the duplication of this sequence on each side of the transposon. It is not yet understood why these elements are spliced, whether by chance, or by some preferential action by the transposon. In tandem genomic duplication, due to the similarity between consensus donor and acceptor splice sites, which both closely resemble AGGT, the tandem genomic duplication of an exonic segment harboring an AGGT sequence generates two potential splice sites. When recognized by the spliceosome, the sequence between the original and duplicated AGGT will be spliced, resulting in the creation of an intron without alteration of the coding sequence of the gene. Double-stranded break repair via non-homologous end joining was recently identified as a source of intron gain when researchers identified short direct repeats flanking 43% of gained introns in Daphnia. [42] These numbers must be compared to the number of conserved introns flanked by repeats in other organisms, though, for statistical relevance. For group II intron insertion, the retrohoming of a group II intron into a nuclear gene was proposed to cause recent spliceosomal intron gain.

Intron transfer has been hypothesized to result in intron gain when a paralog or pseudogene gains an intron and then transfers this intron via recombination to an intron-absent location in its sister paralog. Intronization is the process by which mutations create novel introns from formerly exonic sequence. Thus, unlike other proposed mechanisms of intron gain, this mechanism does not require the insertion or generation of DNA to create a novel intron. [42]

The only hypothesized mechanism of recent intron gain lacking any direct evidence is that of group II intron insertion, which when demonstrated in vivo, abolishes gene expression. [43] Group II introns are therefore likely the presumed ancestors of spliceosomal introns, acting as site-specific retroelements, and are no longer responsible for intron gain. [44] [45] Tandem genomic duplication is the only proposed mechanism with supporting in vivo experimental evidence: a short intragenic tandem duplication can insert a novel intron into a protein-coding gene, leaving the corresponding peptide sequence unchanged. [46] This mechanism also has extensive indirect evidence lending support to the idea that tandem genomic duplication is a prevalent mechanism for intron gain. The testing of other proposed mechanisms in vivo, particularly intron gain during DSBR, intron transfer, and intronization, is possible, although these mechanisms must be demonstrated in vivo to solidify them as actual mechanisms of intron gain. Further genomic analyses, especially when executed at the population level, may then quantify the relative contribution of each mechanism, possibly identifying species-specific biases that may shed light on varied rates of intron gain amongst different species. [42]


Eukaryotic Epigenetic Gene Regulation

The human genome encodes over 20,000 genes each of the 23 pairs of human chromosomes encodes thousands of genes. The DNA in the nucleus is precisely wound, folded, and compacted into chromosomes so that it will fit into the nucleus. It is also organized so that specific segments can be accessed as needed by a specific cell type.

The first level of organization, or packing, is the winding of DNA strands around histone proteins. Histones package and order DNA into structural units called nucleosome complexes, which can control the access of proteins to the DNA regions (Figure 1a). Under the electron microscope, this winding of DNA around histone proteins to form nucleosomes looks like small beads on a string (Figure 1b). These beads (histone proteins) can move along the string (DNA) and change the structure of the molecule.

Figure 1. DNA is folded around histone proteins to create (a) nucleosome complexes. These nucleosomes control the access of proteins to the underlying DNA. When viewed through an electron microscope (b), the nucleosomes look like beads on a string. (credit “micrograph”: modification of work by Chris Woodcock)

If DNA encoding a specific gene is to be transcribed into RNA, the nucleosomes surrounding that region of DNA can slide down the DNA to open that specific chromosomal region and allow for the transcriptional machinery (RNA polymerase) to initiate transcription (Figure 2). Nucleosomes can move to open the chromosome structure to expose a segment of DNA, but do so in a very controlled manner.

Domanda pratica

Figure 2. Nucleosomes can slide along DNA. When nucleosomes are spaced closely together (top), transcription factors cannot bind and gene expression is turned off. When the nucleosomes are spaced far apart (bottom), the DNA is exposed. Transcription factors can bind, allowing gene expression to occur. Modifications to the histones and DNA affect nucleosome spacing.

In females, one of the two X chromosomes is inactivated during embryonic development because of epigenetic changes to the chromatin. What impact do you think these changes would have on nucleosome packing?

This type of gene regulation is called epigenetic regulation. Epigenetic means “around genetics.” The changes that occur to the histone proteins and DNA do not alter the nucleotide sequence and are not permanent. Instead, these changes are temporary (although they often persist through multiple rounds of cell division) and alter the chromosomal structure (open or closed) as needed. A gene can be turned on or off depending upon the location and modifications to the histone proteins and DNA.

View this video that describes how epigenetic regulation controls gene expression.

In Summary: Eukaryotic Epigenetic Gene Regulation

In eukaryotic cells, the first stage of gene expression control occurs at the epigenetic level. Epigenetic mechanisms control access to the chromosomal region to allow genes to be turned on or off. These mechanisms control how DNA is packed into the nucleus by regulating how tightly the DNA is wound around histone proteins. The addition or removal of chemical modifications (or flags) to histone proteins or DNA signals to the cell to open or close a chromosomal region. Therefore, eukaryotic cells can control whether a gene is expressed by controlling accessibility to transcription factors and the binding of RNA polymerase to initiate transcription.


RIGD: A Database for Intronless Genes in the Rosaceae

Most eukaryotic genes are interrupted by one or more introns, and only prokaryotic genomes are composed of mainly single-exon genes without introns. Due to the absence of introns, intronless genes in eukaryotes have become important materials for comparative genomics and evolutionary biology. There is currently no cohesive database that collects intronless genes in plants into a single database, although many databases on exons and introns exist. In this study, we constructed the Rosaceae Intronless Genes Database (RIGD), a user-friendly web interface to explore and collect information on intronless genes from different plants. Six Rosaceae species, Pyrus bretschneideri, Pyrus communis, Malus domestica, Prunus persica, Prunus mume, e Fragaria vesca, are included in the current release of the RIGD. Sequence data and gene annotation were collected from different databases and integrated. The main purpose of this study is to provide gene sequence data. In addition, attribute analysis, functional annotations, subcellular localization prediction, and GO analysis are reported. The RIGD allows users to browse, search, and download data with ease. Blast and comparative analyses are also provided through this online database, which is available at http://www.rigdb.cn/.

Parole chiave: Rosaceae database gene annotations intronless genes platform.

Copyright © 2020 Chen, Meng, Liu, Cheng, Wang, Jin, Xu, Cao and Cai.

Cifre

The flowchart describing the analysis…

The flowchart describing the analysis of RIGD. After the identification of intronless genes,…

The Flowchart of RIGD Sitemap.…

The Flowchart of RIGD Sitemap. All the data is stored in MySQL database,…

An overview of the website…

An overview of the website page in the RIGD. (UN) Home interface show…

The website page of Species.…

The website page of Species. In addition to the download links to the…

The website page of Search.…

The website page of Search. Researchers can search the RIGD database by species…

The website page of Blast.…

The website page of Blast. The interface can be used for Blast comparison…

The statistics of subcellular localization…

The statistics of subcellular localization prediction. The largest number of intronless genes were…

Top 10 largest number of intronless genes in protein function. The largest number…

Subcellular localization prediction of intronless…

Subcellular localization prediction of intronless PPR genes in Pyrus bretschneideri . Most proportion…

Motif analysis and visualization. Motif1…

Motif analysis and visualization. Motif1 is the most covered. Motif3 only existed at…


Guarda il video: La scoperta degli introni (Dicembre 2022).